FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625855_at:

>probe:Drosophila_2:1625855_at:120:307; Interrogation_Position=1003; Antisense; CCTCGCTGTGCGATGAGTACCGGAA
>probe:Drosophila_2:1625855_at:106:385; Interrogation_Position=1073; Antisense; GAACAGGCAGCTACGCGAGATCATC
>probe:Drosophila_2:1625855_at:49:427; Interrogation_Position=1089; Antisense; GAGATCATCGATCGGACACGCATCA
>probe:Drosophila_2:1625855_at:390:559; Interrogation_Position=1102; Antisense; GGACACGCATCATCATCTGGGAGAT
>probe:Drosophila_2:1625855_at:274:529; Interrogation_Position=1120; Antisense; GGGAGATCAACACCATGCTGGCCAT
>probe:Drosophila_2:1625855_at:447:331; Interrogation_Position=1145; Antisense; GCGGCGCTCATAGGCATAGGGACTC
>probe:Drosophila_2:1625855_at:278:187; Interrogation_Position=634; Antisense; AACAGCAACTCAATCCGGTCGCAGG
>probe:Drosophila_2:1625855_at:274:535; Interrogation_Position=650; Antisense; GGTCGCAGGAATTCCACCCGGTGGA
>probe:Drosophila_2:1625855_at:589:685; Interrogation_Position=701; Antisense; TATCTCGCAGCAAAATCCTCACAAG
>probe:Drosophila_2:1625855_at:262:461; Interrogation_Position=728; Antisense; GATTAACATTGTGCAGCTGTCCCGT
>probe:Drosophila_2:1625855_at:566:177; Interrogation_Position=763; Antisense; AAACGGTGCAGGATATCGCCTCGCG
>probe:Drosophila_2:1625855_at:182:101; Interrogation_Position=898; Antisense; AGAGGGTGCGCATCATCTACGAGAA
>probe:Drosophila_2:1625855_at:227:253; Interrogation_Position=926; Antisense; CAACGACGCCGGAATGGATTACATG
>probe:Drosophila_2:1625855_at:159:57; Interrogation_Position=948; Antisense; ATGAGCGCCGAGAGTCTGATTCCCT

Paste this into a BLAST search page for me
CCTCGCTGTGCGATGAGTACCGGAAGAACAGGCAGCTACGCGAGATCATCGAGATCATCGATCGGACACGCATCAGGACACGCATCATCATCTGGGAGATGGGAGATCAACACCATGCTGGCCATGCGGCGCTCATAGGCATAGGGACTCAACAGCAACTCAATCCGGTCGCAGGGGTCGCAGGAATTCCACCCGGTGGATATCTCGCAGCAAAATCCTCACAAGGATTAACATTGTGCAGCTGTCCCGTAAACGGTGCAGGATATCGCCTCGCGAGAGGGTGCGCATCATCTACGAGAACAACGACGCCGGAATGGATTACATGATGAGCGCCGAGAGTCTGATTCCCT

Full Affymetrix probeset data:

Annotations for 1625855_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720