Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625857_at:

>probe:Drosophila_2:1625857_at:344:5; Interrogation_Position=2084; Antisense; ATTGTGGTAGGTGCACTAGTCTCCC
>probe:Drosophila_2:1625857_at:415:449; Interrogation_Position=2141; Antisense; GATCCGGATCTAATATCACCAGTGA
>probe:Drosophila_2:1625857_at:669:513; Interrogation_Position=2162; Antisense; GTGATTCACAGATTCCTTCCAAAAG
>probe:Drosophila_2:1625857_at:581:51; Interrogation_Position=2188; Antisense; ATGCTTTAGTGGTCGCAATCTCCAT
>probe:Drosophila_2:1625857_at:183:625; Interrogation_Position=2212; Antisense; TGCGCAGGCGCACAAAAACCTCTTA
>probe:Drosophila_2:1625857_at:218:263; Interrogation_Position=2260; Antisense; CAGAACTTCCTGTGCCAAACTAATG
>probe:Drosophila_2:1625857_at:290:627; Interrogation_Position=2303; Antisense; TCCACACCCTGTTTTGTTAGCATAG
>probe:Drosophila_2:1625857_at:626:483; Interrogation_Position=2337; Antisense; GTAGTTGCTTTGTGGTAGTTACCTT
>probe:Drosophila_2:1625857_at:397:563; Interrogation_Position=2422; Antisense; GGAACCTATGAATCTGCATCTCAGA
>probe:Drosophila_2:1625857_at:260:247; Interrogation_Position=2506; Antisense; AATTGTTCTGTTTGTATCCGTTCTT
>probe:Drosophila_2:1625857_at:338:667; Interrogation_Position=2531; Antisense; TACTTTCCAGCCTTTGTTCAAGCAT
>probe:Drosophila_2:1625857_at:463:569; Interrogation_Position=2565; Antisense; GGCATTTTCGATTTGTAGTCAGCAG
>probe:Drosophila_2:1625857_at:274:407; Interrogation_Position=2589; Antisense; GACTGTGTCTCATTATGTATTCCGT
>probe:Drosophila_2:1625857_at:463:481; Interrogation_Position=2605; Antisense; GTATTCCGTTTGACTTTACAAGCAT

Paste this into a BLAST search page for me
ATTGTGGTAGGTGCACTAGTCTCCCGATCCGGATCTAATATCACCAGTGAGTGATTCACAGATTCCTTCCAAAAGATGCTTTAGTGGTCGCAATCTCCATTGCGCAGGCGCACAAAAACCTCTTACAGAACTTCCTGTGCCAAACTAATGTCCACACCCTGTTTTGTTAGCATAGGTAGTTGCTTTGTGGTAGTTACCTTGGAACCTATGAATCTGCATCTCAGAAATTGTTCTGTTTGTATCCGTTCTTTACTTTCCAGCCTTTGTTCAAGCATGGCATTTTCGATTTGTAGTCAGCAGGACTGTGTCTCATTATGTATTCCGTGTATTCCGTTTGACTTTACAAGCAT

Full Affymetrix probeset data:

Annotations for 1625857_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime