FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625858_at:

>probe:Drosophila_2:1625858_at:297:493; Interrogation_Position=331; Antisense; GTAATCTTTGTGTGCATTCAGCCCC
>probe:Drosophila_2:1625858_at:631:531; Interrogation_Position=369; Antisense; GGTGGCCTACTTGGGCATCATGCTA
>probe:Drosophila_2:1625858_at:613:123; Interrogation_Position=528; Antisense; AGCGCACAGCTTTTTCATCTTCATA
>probe:Drosophila_2:1625858_at:526:253; Interrogation_Position=555; Antisense; CAACTTCCACTTGATCCTGTACGAT
>probe:Drosophila_2:1625858_at:557:461; Interrogation_Position=595; Antisense; GATTTTGGCGAGAGTCTGCTCAGCT
>probe:Drosophila_2:1625858_at:657:279; Interrogation_Position=613; Antisense; CTCAGCTCGTTCATATGTCCGGTAG
>probe:Drosophila_2:1625858_at:342:487; Interrogation_Position=634; Antisense; GTAGCCCTGCTCCACATAAATGTGA
>probe:Drosophila_2:1625858_at:95:231; Interrogation_Position=652; Antisense; AATGTGACCATTAGCTCCATCGAGA
>probe:Drosophila_2:1625858_at:508:417; Interrogation_Position=695; Antisense; GAGCGAGCTTTAAACCGCAGCGACA
>probe:Drosophila_2:1625858_at:493:607; Interrogation_Position=728; Antisense; TGATGTGGCTCTACATGCACGTGAT
>probe:Drosophila_2:1625858_at:53:169; Interrogation_Position=770; Antisense; AAAGTGGCTTTAATGCCTTTCGCCT
>probe:Drosophila_2:1625858_at:121:217; Interrogation_Position=822; Antisense; AAGATTGGGATGGTCCTTCGCCATG
>probe:Drosophila_2:1625858_at:410:473; Interrogation_Position=846; Antisense; GTTCACAAACGCCATGTTGCTCAAC
>probe:Drosophila_2:1625858_at:668:187; Interrogation_Position=868; Antisense; AACAGCACCGCTAGGCTTAAGCATT

Paste this into a BLAST search page for me
GTAATCTTTGTGTGCATTCAGCCCCGGTGGCCTACTTGGGCATCATGCTAAGCGCACAGCTTTTTCATCTTCATACAACTTCCACTTGATCCTGTACGATGATTTTGGCGAGAGTCTGCTCAGCTCTCAGCTCGTTCATATGTCCGGTAGGTAGCCCTGCTCCACATAAATGTGAAATGTGACCATTAGCTCCATCGAGAGAGCGAGCTTTAAACCGCAGCGACATGATGTGGCTCTACATGCACGTGATAAAGTGGCTTTAATGCCTTTCGCCTAAGATTGGGATGGTCCTTCGCCATGGTTCACAAACGCCATGTTGCTCAACAACAGCACCGCTAGGCTTAAGCATT

Full Affymetrix probeset data:

Annotations for 1625858_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720