FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625859_at:

>probe:Drosophila_2:1625859_at:683:525; Interrogation_Position=1276; Antisense; GGGAGCGGCTTAACACCTTCTGGAA
>probe:Drosophila_2:1625859_at:244:563; Interrogation_Position=1297; Antisense; GGAACGAGTCCAAGGGCCGAATCAT
>probe:Drosophila_2:1625859_at:204:83; Interrogation_Position=1309; Antisense; AGGGCCGAATCATTCAGGCACTCAG
>probe:Drosophila_2:1625859_at:156:67; Interrogation_Position=1340; Antisense; AGGCAGTCCGAATGGCTCCGTAAAC
>probe:Drosophila_2:1625859_at:560:491; Interrogation_Position=1359; Antisense; GTAAACGGTGACGATCCAGACGCAA
>probe:Drosophila_2:1625859_at:228:449; Interrogation_Position=1371; Antisense; GATCCAGACGCAACAGACGACTTAG
>probe:Drosophila_2:1625859_at:127:431; Interrogation_Position=1407; Antisense; GAGTACATGGAGCTGCCACCAGACT
>probe:Drosophila_2:1625859_at:608:485; Interrogation_Position=1441; Antisense; GTAGTTGCGTATCCCTTAGTCGAAA
>probe:Drosophila_2:1625859_at:2:207; Interrogation_Position=1470; Antisense; AAGCGCCCTGATAAGGTGAATGCCT
>probe:Drosophila_2:1625859_at:633:533; Interrogation_Position=1484; Antisense; GGTGAATGCCTCAGCAAACCTCAAT
>probe:Drosophila_2:1625859_at:694:245; Interrogation_Position=1506; Antisense; AATTACTCGGAGCAACCAGAGCATA
>probe:Drosophila_2:1625859_at:474:637; Interrogation_Position=1537; Antisense; TCGTAGACGAGCGACGCAGCGACTA
>probe:Drosophila_2:1625859_at:706:363; Interrogation_Position=1567; Antisense; GAATTTGGCCTCTTCCTATCAATTA
>probe:Drosophila_2:1625859_at:487:561; Interrogation_Position=1622; Antisense; GGAACAGCGCAGTAGGCACTTTTAT

Paste this into a BLAST search page for me
GGGAGCGGCTTAACACCTTCTGGAAGGAACGAGTCCAAGGGCCGAATCATAGGGCCGAATCATTCAGGCACTCAGAGGCAGTCCGAATGGCTCCGTAAACGTAAACGGTGACGATCCAGACGCAAGATCCAGACGCAACAGACGACTTAGGAGTACATGGAGCTGCCACCAGACTGTAGTTGCGTATCCCTTAGTCGAAAAAGCGCCCTGATAAGGTGAATGCCTGGTGAATGCCTCAGCAAACCTCAATAATTACTCGGAGCAACCAGAGCATATCGTAGACGAGCGACGCAGCGACTAGAATTTGGCCTCTTCCTATCAATTAGGAACAGCGCAGTAGGCACTTTTAT

Full Affymetrix probeset data:

Annotations for 1625859_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720