Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625860_s_at:

>probe:Drosophila_2:1625860_s_at:79:703; Interrogation_Position=172; Antisense; TTCTTCATATTTCTGGGAGTGCCCC
>probe:Drosophila_2:1625860_s_at:141:549; Interrogation_Position=187; Antisense; GGAGTGCCCCTGCTTTTTTGTGCAC
>probe:Drosophila_2:1625860_s_at:653:597; Interrogation_Position=216; Antisense; TGTGCCCGCTTGCATATTTTGCCTA
>probe:Drosophila_2:1625860_s_at:492:689; Interrogation_Position=230; Antisense; TATTTTGCCTATTTACCGGCACCTA
>probe:Drosophila_2:1625860_s_at:423:657; Interrogation_Position=253; Antisense; TACTTCTCGTTTTACTCCAAGGCAG
>probe:Drosophila_2:1625860_s_at:562:607; Interrogation_Position=287; Antisense; TGAGGACCAAACCATCGCAGTCTTT
>probe:Drosophila_2:1625860_s_at:191:523; Interrogation_Position=313; Antisense; GTGGCCGAGTGCTATGAACCCTTCA
>probe:Drosophila_2:1625860_s_at:309:341; Interrogation_Position=361; Antisense; GCTAGCTACCAGATATTTACCGAGA
>probe:Drosophila_2:1625860_s_at:607:677; Interrogation_Position=376; Antisense; TTTACCGAGAACTGTCCATACGAGG
>probe:Drosophila_2:1625860_s_at:149:261; Interrogation_Position=460; Antisense; CACGCCGTATACAATGCTGCATGGA
>probe:Drosophila_2:1625860_s_at:379:65; Interrogation_Position=480; Antisense; ATGGATCTATCGCTTTGCCATCGAT
>probe:Drosophila_2:1625860_s_at:717:515; Interrogation_Position=516; Antisense; GTGTCAGACGATCATGGACCCCATG
>probe:Drosophila_2:1625860_s_at:572:383; Interrogation_Position=558; Antisense; GAACTGCATTATCGGCGGGTACGCC
>probe:Drosophila_2:1625860_s_at:698:431; Interrogation_Position=589; Antisense; GAGTGCACTATCTCCGAGTGGCAGG

Paste this into a BLAST search page for me
TTCTTCATATTTCTGGGAGTGCCCCGGAGTGCCCCTGCTTTTTTGTGCACTGTGCCCGCTTGCATATTTTGCCTATATTTTGCCTATTTACCGGCACCTATACTTCTCGTTTTACTCCAAGGCAGTGAGGACCAAACCATCGCAGTCTTTGTGGCCGAGTGCTATGAACCCTTCAGCTAGCTACCAGATATTTACCGAGATTTACCGAGAACTGTCCATACGAGGCACGCCGTATACAATGCTGCATGGAATGGATCTATCGCTTTGCCATCGATGTGTCAGACGATCATGGACCCCATGGAACTGCATTATCGGCGGGTACGCCGAGTGCACTATCTCCGAGTGGCAGG

Full Affymetrix probeset data:

Annotations for 1625860_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime