FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625861_at:

>probe:Drosophila_2:1625861_at:652:153; Interrogation_Position=133; Antisense; ACAGCGGCGGCTATTGGCCAACCAA
>probe:Drosophila_2:1625861_at:425:201; Interrogation_Position=152; Antisense; AACCAATGTTCGTTGCCGAGGCGGT
>probe:Drosophila_2:1625861_at:353:51; Interrogation_Position=238; Antisense; ATGCGTCTGCGGTTTCTGCAACTGG
>probe:Drosophila_2:1625861_at:592:487; Interrogation_Position=267; Antisense; GTACGGTCGAAATTCCGCGAACATG
>probe:Drosophila_2:1625861_at:155:189; Interrogation_Position=334; Antisense; AACACCAAGCGCTTCGTTGTGGAGG
>probe:Drosophila_2:1625861_at:504:547; Interrogation_Position=354; Antisense; GGAGGACTCGATTACCAAGGTGACC
>probe:Drosophila_2:1625861_at:326:445; Interrogation_Position=402; Antisense; GATGACCATGGTGGCCGGATTATCC
>probe:Drosophila_2:1625861_at:725:699; Interrogation_Position=431; Antisense; TTTTGGCGGCCATCATCATTTTGGC
>probe:Drosophila_2:1625861_at:22:517; Interrogation_Position=463; Antisense; GTGTCCATGGTATCTTGTCGCAAGC
>probe:Drosophila_2:1625861_at:659:375; Interrogation_Position=504; Antisense; GAAGAGCAATTCCTCCGCCAATGTG
>probe:Drosophila_2:1625861_at:17:309; Interrogation_Position=533; Antisense; CCATGACCAGTGTGGCGCAGGATCA
>probe:Drosophila_2:1625861_at:77:729; Interrogation_Position=565; Antisense; TTGGCCGGTAACTTGAACGCAGCGT
>probe:Drosophila_2:1625861_at:272:609; Interrogation_Position=594; Antisense; TGAGAGCACTCTGACCTTGGACAAG
>probe:Drosophila_2:1625861_at:42:259; Interrogation_Position=630; Antisense; CACAGAGGATCAATGGCGACCCACA

Paste this into a BLAST search page for me
ACAGCGGCGGCTATTGGCCAACCAAAACCAATGTTCGTTGCCGAGGCGGTATGCGTCTGCGGTTTCTGCAACTGGGTACGGTCGAAATTCCGCGAACATGAACACCAAGCGCTTCGTTGTGGAGGGGAGGACTCGATTACCAAGGTGACCGATGACCATGGTGGCCGGATTATCCTTTTGGCGGCCATCATCATTTTGGCGTGTCCATGGTATCTTGTCGCAAGCGAAGAGCAATTCCTCCGCCAATGTGCCATGACCAGTGTGGCGCAGGATCATTGGCCGGTAACTTGAACGCAGCGTTGAGAGCACTCTGACCTTGGACAAGCACAGAGGATCAATGGCGACCCACA

Full Affymetrix probeset data:

Annotations for 1625861_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720