Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625862_x_at:

>probe:Drosophila_2:1625862_x_at:276:203; Interrogation_Position=223; Antisense; AACCATTCTGGTCCTGTGTACAACA
>probe:Drosophila_2:1625862_x_at:360:477; Interrogation_Position=390; Antisense; GTTTTCAAACGCATCGAACATGACA
>probe:Drosophila_2:1625862_x_at:699:199; Interrogation_Position=397; Antisense; AACGCATCGAACATGACAATTTCAA
>probe:Drosophila_2:1625862_x_at:425:249; Interrogation_Position=413; Antisense; CAATTTCAATGATTTTCTGGGAGGA
>probe:Drosophila_2:1625862_x_at:169:699; Interrogation_Position=425; Antisense; TTTTCTGGGAGGATGGAGTGACAAC
>probe:Drosophila_2:1625862_x_at:6:551; Interrogation_Position=439; Antisense; GGAGTGACAACAGAGCAAGGGCTTT
>probe:Drosophila_2:1625862_x_at:313:359; Interrogation_Position=453; Antisense; GCAAGGGCTTTAATTTTTGAGCCTC
>probe:Drosophila_2:1625862_x_at:206:679; Interrogation_Position=466; Antisense; TTTTTGAGCCTCGAAGTTTAACTAG
>probe:Drosophila_2:1625862_x_at:189:609; Interrogation_Position=470; Antisense; TGAGCCTCGAAGTTTAACTAGGTTA
>probe:Drosophila_2:1625862_x_at:366:687; Interrogation_Position=492; Antisense; TTACGATACCTTCTAACCGCCTTTG
>probe:Drosophila_2:1625862_x_at:450:455; Interrogation_Position=496; Antisense; GATACCTTCTAACCGCCTTTGAATT
>probe:Drosophila_2:1625862_x_at:20:313; Interrogation_Position=510; Antisense; GCCTTTGAATTTTACGACCGAGTTG
>probe:Drosophila_2:1625862_x_at:28:243; Interrogation_Position=517; Antisense; AATTTTACGACCGAGTTGCATTTGG
>probe:Drosophila_2:1625862_x_at:727:671; Interrogation_Position=522; Antisense; TACGACCGAGTTGCATTTGGGTGAG

Paste this into a BLAST search page for me
AACCATTCTGGTCCTGTGTACAACAGTTTTCAAACGCATCGAACATGACAAACGCATCGAACATGACAATTTCAACAATTTCAATGATTTTCTGGGAGGATTTTCTGGGAGGATGGAGTGACAACGGAGTGACAACAGAGCAAGGGCTTTGCAAGGGCTTTAATTTTTGAGCCTCTTTTTGAGCCTCGAAGTTTAACTAGTGAGCCTCGAAGTTTAACTAGGTTATTACGATACCTTCTAACCGCCTTTGGATACCTTCTAACCGCCTTTGAATTGCCTTTGAATTTTACGACCGAGTTGAATTTTACGACCGAGTTGCATTTGGTACGACCGAGTTGCATTTGGGTGAG

Full Affymetrix probeset data:

Annotations for 1625862_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime