FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625863_at:

>probe:Drosophila_2:1625863_at:96:133; Interrogation_Position=103; Antisense; ACGCGCCGACCCATGAGTGACAAAG
>probe:Drosophila_2:1625863_at:656:211; Interrogation_Position=125; Antisense; AAGAGTTGAACTTCGTCCTGGGCGT
>probe:Drosophila_2:1625863_at:9:91; Interrogation_Position=152; Antisense; AGTACCGACGCAACGATCCGGAGTT
>probe:Drosophila_2:1625863_at:491:305; Interrogation_Position=169; Antisense; CCGGAGTTCTATCGCCAAGTGCAAG
>probe:Drosophila_2:1625863_at:246:221; Interrogation_Position=185; Antisense; AAGTGCAAGTCAACCTGCGCGATGG
>probe:Drosophila_2:1625863_at:237:327; Interrogation_Position=203; Antisense; GCGATGGCGTCGAATACGGCATTCT
>probe:Drosophila_2:1625863_at:298:141; Interrogation_Position=218; Antisense; ACGGCATTCTGAAACGCCAGGGAAA
>probe:Drosophila_2:1625863_at:381:81; Interrogation_Position=236; Antisense; AGGGAAACCAGTTTTCGCTGCGATC
>probe:Drosophila_2:1625863_at:20:451; Interrogation_Position=257; Antisense; GATCCCGACGCCTTGGTGAACTGAT
>probe:Drosophila_2:1625863_at:645:381; Interrogation_Position=274; Antisense; GAACTGATGTCTACTCTTGGATCCT
>probe:Drosophila_2:1625863_at:281:357; Interrogation_Position=35; Antisense; GCACACTGCCGCAACAGCGGAAGTT
>probe:Drosophila_2:1625863_at:678:373; Interrogation_Position=54; Antisense; GAAGTTGGTCCCCAACCTACTGAGG
>probe:Drosophila_2:1625863_at:77:203; Interrogation_Position=67; Antisense; AACCTACTGAGGTCCATACTACGCG
>probe:Drosophila_2:1625863_at:109:79; Interrogation_Position=76; Antisense; AGGTCCATACTACGCGTCCTGGAGG

Paste this into a BLAST search page for me
ACGCGCCGACCCATGAGTGACAAAGAAGAGTTGAACTTCGTCCTGGGCGTAGTACCGACGCAACGATCCGGAGTTCCGGAGTTCTATCGCCAAGTGCAAGAAGTGCAAGTCAACCTGCGCGATGGGCGATGGCGTCGAATACGGCATTCTACGGCATTCTGAAACGCCAGGGAAAAGGGAAACCAGTTTTCGCTGCGATCGATCCCGACGCCTTGGTGAACTGATGAACTGATGTCTACTCTTGGATCCTGCACACTGCCGCAACAGCGGAAGTTGAAGTTGGTCCCCAACCTACTGAGGAACCTACTGAGGTCCATACTACGCGAGGTCCATACTACGCGTCCTGGAGG

Full Affymetrix probeset data:

Annotations for 1625863_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720