FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625864_at:

>probe:Drosophila_2:1625864_at:108:401; Interrogation_Position=2080; Antisense; GACATGCTGGCCAACCTGAACAACA
>probe:Drosophila_2:1625864_at:528:455; Interrogation_Position=2109; Antisense; GATAAACCCCATCGACAAGCTGTAT
>probe:Drosophila_2:1625864_at:655:333; Interrogation_Position=2127; Antisense; GCTGTATCTCATGCAGAACTCGTAC
>probe:Drosophila_2:1625864_at:283:107; Interrogation_Position=2141; Antisense; AGAACTCGTACTTCAGCTCGGAGCA
>probe:Drosophila_2:1625864_at:54:263; Interrogation_Position=2154; Antisense; CAGCTCGGAGCATTAGATGGCCATT
>probe:Drosophila_2:1625864_at:28:233; Interrogation_Position=2185; Antisense; AATGACAGGGAAGCACCGAGGCGAT
>probe:Drosophila_2:1625864_at:652:675; Interrogation_Position=2232; Antisense; TAGCGTTAGAGTGGCAGGATCCGAT
>probe:Drosophila_2:1625864_at:114:327; Interrogation_Position=2268; Antisense; GCGAGGTCCTTGCTGTTACTTTAAA
>probe:Drosophila_2:1625864_at:701:173; Interrogation_Position=2291; Antisense; AAACGTAGCGCGTAGTTGGCACCTT
>probe:Drosophila_2:1625864_at:159:297; Interrogation_Position=2317; Antisense; CGCATTCGGCGCATTAAGTTGGAGT
>probe:Drosophila_2:1625864_at:5:527; Interrogation_Position=2437; Antisense; GGGCAGCACATCTTTTTGTTGGTAT
>probe:Drosophila_2:1625864_at:333:567; Interrogation_Position=2511; Antisense; GGCAAAGTGGTCAATGCGCCCTCTT
>probe:Drosophila_2:1625864_at:69:235; Interrogation_Position=2523; Antisense; AATGCGCCCTCTTATGTTTGTAAAT
>probe:Drosophila_2:1625864_at:256:85; Interrogation_Position=2611; Antisense; AGTGCAATTTAATCTGTTCCCCTAA

Paste this into a BLAST search page for me
GACATGCTGGCCAACCTGAACAACAGATAAACCCCATCGACAAGCTGTATGCTGTATCTCATGCAGAACTCGTACAGAACTCGTACTTCAGCTCGGAGCACAGCTCGGAGCATTAGATGGCCATTAATGACAGGGAAGCACCGAGGCGATTAGCGTTAGAGTGGCAGGATCCGATGCGAGGTCCTTGCTGTTACTTTAAAAAACGTAGCGCGTAGTTGGCACCTTCGCATTCGGCGCATTAAGTTGGAGTGGGCAGCACATCTTTTTGTTGGTATGGCAAAGTGGTCAATGCGCCCTCTTAATGCGCCCTCTTATGTTTGTAAATAGTGCAATTTAATCTGTTCCCCTAA

Full Affymetrix probeset data:

Annotations for 1625864_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720