FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625866_at:

>probe:Drosophila_2:1625866_at:659:55; Interrogation_Position=13; Antisense; ATGAAATCCATCCTTGTGCTCGCCT
>probe:Drosophila_2:1625866_at:291:613; Interrogation_Position=14; Antisense; TGAAATCCATCCTTGTGCTCGCCTG
>probe:Drosophila_2:1625866_at:49:727; Interrogation_Position=26; Antisense; TTGTGCTCGCCTGCCTTTTAAGTGC
>probe:Drosophila_2:1625866_at:712:541; Interrogation_Position=283; Antisense; GGATTCCAACCCCAGGGCGAGGATA
>probe:Drosophila_2:1625866_at:699:463; Interrogation_Position=284; Antisense; GATTCCAACCCCAGGGCGAGGATAT
>probe:Drosophila_2:1625866_at:483:3; Interrogation_Position=285; Antisense; ATTCCAACCCCAGGGCGAGGATATT
>probe:Drosophila_2:1625866_at:264:83; Interrogation_Position=296; Antisense; AGGGCGAGGATATTCCCCACCTATA
>probe:Drosophila_2:1625866_at:704:523; Interrogation_Position=297; Antisense; GGGCGAGGATATTCCCCACCTATAA
>probe:Drosophila_2:1625866_at:364:633; Interrogation_Position=32; Antisense; TCGCCTGCCTTTTAAGTGCCCTGTG
>probe:Drosophila_2:1625866_at:639:601; Interrogation_Position=37; Antisense; TGCCTTTTAAGTGCCCTGTGCCTAG
>probe:Drosophila_2:1625866_at:514:275; Interrogation_Position=40; Antisense; CTTTTAAGTGCCCTGTGCCTAGCTG
>probe:Drosophila_2:1625866_at:318:701; Interrogation_Position=41; Antisense; TTTTAAGTGCCCTGTGCCTAGCTGC
>probe:Drosophila_2:1625866_at:178:711; Interrogation_Position=43; Antisense; TTAAGTGCCCTGTGCCTAGCTGCTG
>probe:Drosophila_2:1625866_at:662:655; Interrogation_Position=44; Antisense; TAAGTGCCCTGTGCCTAGCTGCTGC

Paste this into a BLAST search page for me
ATGAAATCCATCCTTGTGCTCGCCTTGAAATCCATCCTTGTGCTCGCCTGTTGTGCTCGCCTGCCTTTTAAGTGCGGATTCCAACCCCAGGGCGAGGATAGATTCCAACCCCAGGGCGAGGATATATTCCAACCCCAGGGCGAGGATATTAGGGCGAGGATATTCCCCACCTATAGGGCGAGGATATTCCCCACCTATAATCGCCTGCCTTTTAAGTGCCCTGTGTGCCTTTTAAGTGCCCTGTGCCTAGCTTTTAAGTGCCCTGTGCCTAGCTGTTTTAAGTGCCCTGTGCCTAGCTGCTTAAGTGCCCTGTGCCTAGCTGCTGTAAGTGCCCTGTGCCTAGCTGCTGC

Full Affymetrix probeset data:

Annotations for 1625866_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720