FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625869_at:

>probe:Drosophila_2:1625869_at:702:273; Interrogation_Position=13; Antisense; CTTCAGTCCGACTTGTCAAACCGAT
>probe:Drosophila_2:1625869_at:337:63; Interrogation_Position=243; Antisense; ATGTGGACCCTGCTATGGACCGAAT
>probe:Drosophila_2:1625869_at:675:369; Interrogation_Position=264; Antisense; GAATGTCTGCGGACCATGCTATGCC
>probe:Drosophila_2:1625869_at:113:493; Interrogation_Position=27; Antisense; GTCAAACCGATATACCTGTGCGTAA
>probe:Drosophila_2:1625869_at:652:521; Interrogation_Position=299; Antisense; GTGGCGGCTGCTATTGTGGATACCC
>probe:Drosophila_2:1625869_at:352:519; Interrogation_Position=314; Antisense; GTGGATACCCTTGCTGCTAGACAGT
>probe:Drosophila_2:1625869_at:3:341; Interrogation_Position=329; Antisense; GCTAGACAGTTGCAACTGGCCATGT
>probe:Drosophila_2:1625869_at:120:581; Interrogation_Position=345; Antisense; TGGCCATGTCCAAGAAGGGTTCACC
>probe:Drosophila_2:1625869_at:443:471; Interrogation_Position=363; Antisense; GTTCACCAGAACACCAAGACGATAG
>probe:Drosophila_2:1625869_at:405:455; Interrogation_Position=388; Antisense; GATAGAACCTATCCCTATTTCATCC
>probe:Drosophila_2:1625869_at:168:307; Interrogation_Position=401; Antisense; CCTATTTCATCCTCGTATTCATCTA
>probe:Drosophila_2:1625869_at:421:507; Interrogation_Position=44; Antisense; GTGCGTAACCAGATTTTGTATCATT
>probe:Drosophila_2:1625869_at:18:689; Interrogation_Position=68; Antisense; TATTATTTGTCCTTTCGGCCTGAAC
>probe:Drosophila_2:1625869_at:550:271; Interrogation_Position=94; Antisense; CATCAAAATTTGTCGTCTAGTCTCA

Paste this into a BLAST search page for me
CTTCAGTCCGACTTGTCAAACCGATATGTGGACCCTGCTATGGACCGAATGAATGTCTGCGGACCATGCTATGCCGTCAAACCGATATACCTGTGCGTAAGTGGCGGCTGCTATTGTGGATACCCGTGGATACCCTTGCTGCTAGACAGTGCTAGACAGTTGCAACTGGCCATGTTGGCCATGTCCAAGAAGGGTTCACCGTTCACCAGAACACCAAGACGATAGGATAGAACCTATCCCTATTTCATCCCCTATTTCATCCTCGTATTCATCTAGTGCGTAACCAGATTTTGTATCATTTATTATTTGTCCTTTCGGCCTGAACCATCAAAATTTGTCGTCTAGTCTCA

Full Affymetrix probeset data:

Annotations for 1625869_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720