FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625870_at:

>probe:Drosophila_2:1625870_at:624:713; Interrogation_Position=1159; Antisense; TTCATCTCCATACCGGTCTTTCTGA
>probe:Drosophila_2:1625870_at:447:605; Interrogation_Position=1190; Antisense; TGATCCTGTACACCTTTAGTCACTT
>probe:Drosophila_2:1625870_at:389:569; Interrogation_Position=1258; Antisense; GGCATAGTATTCTGCGGCGGCGCCA
>probe:Drosophila_2:1625870_at:373:331; Interrogation_Position=1274; Antisense; GCGGCGCCATGGTGCACAACGTGTT
>probe:Drosophila_2:1625870_at:451:159; Interrogation_Position=1289; Antisense; ACAACGTGTTCGTGTGGCAGCGCGA
>probe:Drosophila_2:1625870_at:585:323; Interrogation_Position=1308; Antisense; GCGCGAGAAGACCATTAGCTACCGT
>probe:Drosophila_2:1625870_at:409:15; Interrogation_Position=1321; Antisense; ATTAGCTACCGTGGAGCACCGCTGT
>probe:Drosophila_2:1625870_at:12:161; Interrogation_Position=1349; Antisense; ACAACTTGTCGGTGATCTCGGCTGG
>probe:Drosophila_2:1625870_at:434:29; Interrogation_Position=1517; Antisense; TTAACCCACTTCTCCTTGGTGGAGG
>probe:Drosophila_2:1625870_at:340:551; Interrogation_Position=1555; Antisense; GGAGCACTGGGTGCCGTTAACTCCT
>probe:Drosophila_2:1625870_at:310:473; Interrogation_Position=1570; Antisense; GTTAACTCCTCATTTCTGGTGCGTC
>probe:Drosophila_2:1625870_at:712:187; Interrogation_Position=1629; Antisense; AACACTGGCGAATAGCAGCTGCCTA
>probe:Drosophila_2:1625870_at:35:117; Interrogation_Position=1645; Antisense; AGCTGCCTAACAGCAGGTCGCGAGG
>probe:Drosophila_2:1625870_at:657:7; Interrogation_Position=1693; Antisense; ATTCCGCCAACGCTGGACATGAGCA

Paste this into a BLAST search page for me
TTCATCTCCATACCGGTCTTTCTGATGATCCTGTACACCTTTAGTCACTTGGCATAGTATTCTGCGGCGGCGCCAGCGGCGCCATGGTGCACAACGTGTTACAACGTGTTCGTGTGGCAGCGCGAGCGCGAGAAGACCATTAGCTACCGTATTAGCTACCGTGGAGCACCGCTGTACAACTTGTCGGTGATCTCGGCTGGTTAACCCACTTCTCCTTGGTGGAGGGGAGCACTGGGTGCCGTTAACTCCTGTTAACTCCTCATTTCTGGTGCGTCAACACTGGCGAATAGCAGCTGCCTAAGCTGCCTAACAGCAGGTCGCGAGGATTCCGCCAACGCTGGACATGAGCA

Full Affymetrix probeset data:

Annotations for 1625870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720