Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625872_at:

>probe:Drosophila_2:1625872_at:506:685; Interrogation_Position=123; Antisense; TATTTCCCGAAATATGCGCAAGGAC
>probe:Drosophila_2:1625872_at:76:325; Interrogation_Position=138; Antisense; GCGCAAGGACGATTGGACATATCTA
>probe:Drosophila_2:1625872_at:31:403; Interrogation_Position=153; Antisense; GACATATCTACAACGCCATCCAGAG
>probe:Drosophila_2:1625872_at:668:307; Interrogation_Position=168; Antisense; CCATCCAGAGATCCGAGCCATAATT
>probe:Drosophila_2:1625872_at:553:309; Interrogation_Position=184; Antisense; GCCATAATTCGGGTCATTACAGCCG
>probe:Drosophila_2:1625872_at:320:123; Interrogation_Position=204; Antisense; AGCCGAGGCGGTTAAGGCAAAGCCA
>probe:Drosophila_2:1625872_at:215:567; Interrogation_Position=219; Antisense; GGCAAAGCCATCGAATATCTACCAA
>probe:Drosophila_2:1625872_at:581:187; Interrogation_Position=27; Antisense; AACATCAAGCGCTGAGGAAACCGAA
>probe:Drosophila_2:1625872_at:424:629; Interrogation_Position=339; Antisense; TCCTGACGAAGGATGTGCCCCGTTT
>probe:Drosophila_2:1625872_at:39:625; Interrogation_Position=354; Antisense; TGCCCCGTTTCCAGAATCCAGCGAG
>probe:Drosophila_2:1625872_at:74:49; Interrogation_Position=369; Antisense; ATCCAGCGAGACTTCTTCGGAAACT
>probe:Drosophila_2:1625872_at:228:179; Interrogation_Position=401; Antisense; AAACTAATTTTAATACCACTGCGAG
>probe:Drosophila_2:1625872_at:216:257; Interrogation_Position=417; Antisense; CACTGCGAGTTTCAACATACCCGAA
>probe:Drosophila_2:1625872_at:470:671; Interrogation_Position=434; Antisense; TACCCGAAAAGCAAGTTTGCCCTGA

Paste this into a BLAST search page for me
TATTTCCCGAAATATGCGCAAGGACGCGCAAGGACGATTGGACATATCTAGACATATCTACAACGCCATCCAGAGCCATCCAGAGATCCGAGCCATAATTGCCATAATTCGGGTCATTACAGCCGAGCCGAGGCGGTTAAGGCAAAGCCAGGCAAAGCCATCGAATATCTACCAAAACATCAAGCGCTGAGGAAACCGAATCCTGACGAAGGATGTGCCCCGTTTTGCCCCGTTTCCAGAATCCAGCGAGATCCAGCGAGACTTCTTCGGAAACTAAACTAATTTTAATACCACTGCGAGCACTGCGAGTTTCAACATACCCGAATACCCGAAAAGCAAGTTTGCCCTGA

Full Affymetrix probeset data:

Annotations for 1625872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime