FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625873_at:

>probe:Drosophila_2:1625873_at:343:79; Interrogation_Position=1007; Antisense; AGGTATTCATTACCCACGGTGGCTT
>probe:Drosophila_2:1625873_at:565:139; Interrogation_Position=1022; Antisense; ACGGTGGCTTATTTGGCACCCAGGA
>probe:Drosophila_2:1625873_at:350:433; Interrogation_Position=1049; Antisense; GAGTGCATTATGCTGTGCCCATGCT
>probe:Drosophila_2:1625873_at:268:593; Interrogation_Position=1073; Antisense; TGGGTATACCCTTCTACTGTGATCA
>probe:Drosophila_2:1625873_at:342:457; Interrogation_Position=1130; Antisense; GATATGCCATTAGTCTGCACTTCCA
>probe:Drosophila_2:1625873_at:362:637; Interrogation_Position=1143; Antisense; TCTGCACTTCCAATCGATTACCGAG
>probe:Drosophila_2:1625873_at:610:415; Interrogation_Position=1264; Antisense; GAGCCGCGAAAAAGTGCCGTCTATT
>probe:Drosophila_2:1625873_at:609:297; Interrogation_Position=1293; Antisense; CGAATATGTCATCCGGCATCGAGGT
>probe:Drosophila_2:1625873_at:38:713; Interrogation_Position=1320; Antisense; TTCACATATGAGATCCGCAGGCCTG
>probe:Drosophila_2:1625873_at:69:71; Interrogation_Position=1338; Antisense; AGGCCTGGATCTCAACTGGTTCCAA
>probe:Drosophila_2:1625873_at:661:277; Interrogation_Position=1394; Antisense; CTATCATTGCTTTAGCTGGCGTCAT
>probe:Drosophila_2:1625873_at:404:643; Interrogation_Position=1422; Antisense; TCTCTCATTGGCCATTCGATTACTG
>probe:Drosophila_2:1625873_at:209:419; Interrogation_Position=927; Antisense; GAGCATTAGCCAATTGCCAGATAAC
>probe:Drosophila_2:1625873_at:438:151; Interrogation_Position=983; Antisense; ACATTCTGGCCCATCGTCATGTGAA

Paste this into a BLAST search page for me
AGGTATTCATTACCCACGGTGGCTTACGGTGGCTTATTTGGCACCCAGGAGAGTGCATTATGCTGTGCCCATGCTTGGGTATACCCTTCTACTGTGATCAGATATGCCATTAGTCTGCACTTCCATCTGCACTTCCAATCGATTACCGAGGAGCCGCGAAAAAGTGCCGTCTATTCGAATATGTCATCCGGCATCGAGGTTTCACATATGAGATCCGCAGGCCTGAGGCCTGGATCTCAACTGGTTCCAACTATCATTGCTTTAGCTGGCGTCATTCTCTCATTGGCCATTCGATTACTGGAGCATTAGCCAATTGCCAGATAACACATTCTGGCCCATCGTCATGTGAA

Full Affymetrix probeset data:

Annotations for 1625873_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720