Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625874_at:

>probe:Drosophila_2:1625874_at:649:419; Interrogation_Position=2281; Antisense; GAGCATCGTCCTCCACCAAGGAAAA
>probe:Drosophila_2:1625874_at:491:185; Interrogation_Position=2316; Antisense; AAAATCACGAAAGCGTCCCACCGAT
>probe:Drosophila_2:1625874_at:609:699; Interrogation_Position=2353; Antisense; TTTTGGTCCGGCGAGTTGTCAGCGC
>probe:Drosophila_2:1625874_at:561:129; Interrogation_Position=2384; Antisense; ACCAGGATCATCAGCGCGACTTCGA
>probe:Drosophila_2:1625874_at:334:373; Interrogation_Position=2412; Antisense; GAAGATCATGAAACAGGTCGCCAAT
>probe:Drosophila_2:1625874_at:454:197; Interrogation_Position=2457; Antisense; AACGGATCAGTGTCTGGTGCAGAAT
>probe:Drosophila_2:1625874_at:155:509; Interrogation_Position=2473; Antisense; GTGCAGAATGCCCAACCGCTTGGTG
>probe:Drosophila_2:1625874_at:274:671; Interrogation_Position=2503; Antisense; TACGTGCGACTCGAGTCCGAATGGA
>probe:Drosophila_2:1625874_at:163:447; Interrogation_Position=2532; Antisense; GATGCTCAAGCAACGTCACAGCCAT
>probe:Drosophila_2:1625874_at:244:139; Interrogation_Position=2560; Antisense; ACGATCCAGGGAACCAATGCCACTG
>probe:Drosophila_2:1625874_at:366:585; Interrogation_Position=2583; Antisense; TGGCACATCCGTGGCTCAAAGCAAC
>probe:Drosophila_2:1625874_at:552:593; Interrogation_Position=2618; Antisense; TGGGATCCGCACTTGCAACTGGTGG
>probe:Drosophila_2:1625874_at:566:515; Interrogation_Position=2650; Antisense; GTGTCCGTCATGTCCAAGCAAAAGC
>probe:Drosophila_2:1625874_at:145:5; Interrogation_Position=2716; Antisense; ATTGGATTCGCCAGCAAGCATCGTA

Paste this into a BLAST search page for me
GAGCATCGTCCTCCACCAAGGAAAAAAAATCACGAAAGCGTCCCACCGATTTTTGGTCCGGCGAGTTGTCAGCGCACCAGGATCATCAGCGCGACTTCGAGAAGATCATGAAACAGGTCGCCAATAACGGATCAGTGTCTGGTGCAGAATGTGCAGAATGCCCAACCGCTTGGTGTACGTGCGACTCGAGTCCGAATGGAGATGCTCAAGCAACGTCACAGCCATACGATCCAGGGAACCAATGCCACTGTGGCACATCCGTGGCTCAAAGCAACTGGGATCCGCACTTGCAACTGGTGGGTGTCCGTCATGTCCAAGCAAAAGCATTGGATTCGCCAGCAAGCATCGTA

Full Affymetrix probeset data:

Annotations for 1625874_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime