FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625875_at:

>probe:Drosophila_2:1625875_at:1:515; Interrogation_Position=110; Antisense; GTGTTCCAGAACCACGATGACGTGC
>probe:Drosophila_2:1625875_at:268:611; Interrogation_Position=127; Antisense; TGACGTGCACATCTCCTTCGAGGAT
>probe:Drosophila_2:1625875_at:327:545; Interrogation_Position=159; Antisense; GGATCAACCGCTTTGCGAAGCACAA
>probe:Drosophila_2:1625875_at:545:621; Interrogation_Position=172; Antisense; TGCGAAGCACAACGCCCGCATGGAT
>probe:Drosophila_2:1625875_at:222:349; Interrogation_Position=189; Antisense; GCATGGATGACTTCAAAGCGGAGCT
>probe:Drosophila_2:1625875_at:636:95; Interrogation_Position=261; Antisense; AGATTGAGCTGTTCGACGAGGACGA
>probe:Drosophila_2:1625875_at:262:75; Interrogation_Position=279; Antisense; AGGACGAGGACATACCGTTCCTGGT
>probe:Drosophila_2:1625875_at:522:27; Interrogation_Position=290; Antisense; ATACCGTTCCTGGTTGGCGAGGTGT
>probe:Drosophila_2:1625875_at:602:603; Interrogation_Position=312; Antisense; TGTTCCTCTCGCACAAGCTGGAGAA
>probe:Drosophila_2:1625875_at:511:615; Interrogation_Position=435; Antisense; TGAAGGCTCATCTGTACCAGCGGTT
>probe:Drosophila_2:1625875_at:290:601; Interrogation_Position=447; Antisense; TGTACCAGCGGTTCGGCAGCAATAT
>probe:Drosophila_2:1625875_at:81:351; Interrogation_Position=462; Antisense; GCAGCAATATCTCACTGGAGGCCGA
>probe:Drosophila_2:1625875_at:44:547; Interrogation_Position=478; Antisense; GGAGGCCGAGGATTAATCCACAATT
>probe:Drosophila_2:1625875_at:328:123; Interrogation_Position=91; Antisense; AGCGAGCGGCACGAACAAAGTGTTC

Paste this into a BLAST search page for me
GTGTTCCAGAACCACGATGACGTGCTGACGTGCACATCTCCTTCGAGGATGGATCAACCGCTTTGCGAAGCACAATGCGAAGCACAACGCCCGCATGGATGCATGGATGACTTCAAAGCGGAGCTAGATTGAGCTGTTCGACGAGGACGAAGGACGAGGACATACCGTTCCTGGTATACCGTTCCTGGTTGGCGAGGTGTTGTTCCTCTCGCACAAGCTGGAGAATGAAGGCTCATCTGTACCAGCGGTTTGTACCAGCGGTTCGGCAGCAATATGCAGCAATATCTCACTGGAGGCCGAGGAGGCCGAGGATTAATCCACAATTAGCGAGCGGCACGAACAAAGTGTTC

Full Affymetrix probeset data:

Annotations for 1625875_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720