FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625876_at:

>probe:Drosophila_2:1625876_at:534:193; Interrogation_Position=1019; Antisense; AACTCTGTTTACTTTATGCATTCTT
>probe:Drosophila_2:1625876_at:683:607; Interrogation_Position=499; Antisense; TGAGCTGCTCATTGGCGGCGAAATC
>probe:Drosophila_2:1625876_at:269:107; Interrogation_Position=540; Antisense; AGAACGTACTTAAGGCGATTGCCTC
>probe:Drosophila_2:1625876_at:478:635; Interrogation_Position=563; Antisense; TCGCAGGATCTGCTCCAAGAGGATG
>probe:Drosophila_2:1625876_at:704:213; Interrogation_Position=579; Antisense; AAGAGGATGAGACCCCGCAGAGTTT
>probe:Drosophila_2:1625876_at:96:351; Interrogation_Position=595; Antisense; GCAGAGTTTCTTCGACGATCACGGC
>probe:Drosophila_2:1625876_at:105:305; Interrogation_Position=619; Antisense; CCTGGGCTAAGTTGGCTCTATGCAA
>probe:Drosophila_2:1625876_at:336:689; Interrogation_Position=670; Antisense; TATTGAACCCATTTAAAGTCGCCTT
>probe:Drosophila_2:1625876_at:59:699; Interrogation_Position=745; Antisense; TTTAACCACCCTGTGTCAGCATAAA
>probe:Drosophila_2:1625876_at:385:373; Interrogation_Position=784; Antisense; GAAGTGCTGTTAAACCTATTCCTAA
>probe:Drosophila_2:1625876_at:18:131; Interrogation_Position=797; Antisense; ACCTATTCCTAATTTCGCTTGGCAA
>probe:Drosophila_2:1625876_at:268:33; Interrogation_Position=858; Antisense; ATCAATATCGGTTGCTCACACACGT
>probe:Drosophila_2:1625876_at:449:541; Interrogation_Position=867; Antisense; GGTTGCTCACACACGTTCATATTTG
>probe:Drosophila_2:1625876_at:687:653; Interrogation_Position=933; Antisense; TAATCGACGGTGTGCTCAACTCTAT

Paste this into a BLAST search page for me
AACTCTGTTTACTTTATGCATTCTTTGAGCTGCTCATTGGCGGCGAAATCAGAACGTACTTAAGGCGATTGCCTCTCGCAGGATCTGCTCCAAGAGGATGAAGAGGATGAGACCCCGCAGAGTTTGCAGAGTTTCTTCGACGATCACGGCCCTGGGCTAAGTTGGCTCTATGCAATATTGAACCCATTTAAAGTCGCCTTTTTAACCACCCTGTGTCAGCATAAAGAAGTGCTGTTAAACCTATTCCTAAACCTATTCCTAATTTCGCTTGGCAAATCAATATCGGTTGCTCACACACGTGGTTGCTCACACACGTTCATATTTGTAATCGACGGTGTGCTCAACTCTAT

Full Affymetrix probeset data:

Annotations for 1625876_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720