FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625878_at:

>probe:Drosophila_2:1625878_at:55:593; Interrogation_Position=1876; Antisense; TGGTGCGGGAGCAAGCCAAAACTCT
>probe:Drosophila_2:1625878_at:698:613; Interrogation_Position=1900; Antisense; TGAAGGCCTTCGACATCCTGAAGCT
>probe:Drosophila_2:1625878_at:726:377; Interrogation_Position=1919; Antisense; GAAGCTCTGCGATGATCTACGCGAC
>probe:Drosophila_2:1625878_at:125:673; Interrogation_Position=1936; Antisense; TACGCGACAATGTGCTGCCCAATTT
>probe:Drosophila_2:1625878_at:331:49; Interrogation_Position=1996; Antisense; ATGCCGTAAAGCTAGTCGACCGCGA
>probe:Drosophila_2:1625878_at:162:411; Interrogation_Position=2013; Antisense; GACCGCGACTCACTTTTACGAGAAC
>probe:Drosophila_2:1625878_at:611:205; Interrogation_Position=2125; Antisense; AAGCCCAGCGACGTGTGAATCCCAA
>probe:Drosophila_2:1625878_at:21:3; Interrogation_Position=2143; Antisense; ATCCCAAGGAAATGTTCCTGGCCGA
>probe:Drosophila_2:1625878_at:500:387; Interrogation_Position=2172; Antisense; GAAAAGTACTCAGCGTTCGACGAAA
>probe:Drosophila_2:1625878_at:335:315; Interrogation_Position=2184; Antisense; GCGTTCGACGAAAATGGCCTTCCCA
>probe:Drosophila_2:1625878_at:400:725; Interrogation_Position=2311; Antisense; TTGAGAAAGCCTGAGACCTAAGATC
>probe:Drosophila_2:1625878_at:514:413; Interrogation_Position=2325; Antisense; GACCTAAGATCAGAGCCACCATGTT
>probe:Drosophila_2:1625878_at:654:213; Interrogation_Position=2407; Antisense; AAGAGATTTCAGTTCCCAGCTTGAA
>probe:Drosophila_2:1625878_at:312:469; Interrogation_Position=2418; Antisense; GTTCCCAGCTTGAAGCAATCCATCT

Paste this into a BLAST search page for me
TGGTGCGGGAGCAAGCCAAAACTCTTGAAGGCCTTCGACATCCTGAAGCTGAAGCTCTGCGATGATCTACGCGACTACGCGACAATGTGCTGCCCAATTTATGCCGTAAAGCTAGTCGACCGCGAGACCGCGACTCACTTTTACGAGAACAAGCCCAGCGACGTGTGAATCCCAAATCCCAAGGAAATGTTCCTGGCCGAGAAAAGTACTCAGCGTTCGACGAAAGCGTTCGACGAAAATGGCCTTCCCATTGAGAAAGCCTGAGACCTAAGATCGACCTAAGATCAGAGCCACCATGTTAAGAGATTTCAGTTCCCAGCTTGAAGTTCCCAGCTTGAAGCAATCCATCT

Full Affymetrix probeset data:

Annotations for 1625878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720