FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625879_at:

>probe:Drosophila_2:1625879_at:229:183; Interrogation_Position=1044; Antisense; AAAACGCATTACATTCCTCAAGCAA
>probe:Drosophila_2:1625879_at:439:7; Interrogation_Position=1056; Antisense; ATTCCTCAAGCAAAACACGTCTAAT
>probe:Drosophila_2:1625879_at:266:551; Interrogation_Position=524; Antisense; GGAGAAATCTCTGGGAATTTACCAA
>probe:Drosophila_2:1625879_at:195:243; Interrogation_Position=546; Antisense; CAATAAGTCCCTGCAAATGAAGTTG
>probe:Drosophila_2:1625879_at:262:615; Interrogation_Position=563; Antisense; TGAAGTTGCTAAATGCCTGGCATTC
>probe:Drosophila_2:1625879_at:320:583; Interrogation_Position=580; Antisense; TGGCATTCAGCCTTTAAACTCTAAG
>probe:Drosophila_2:1625879_at:593:689; Interrogation_Position=635; Antisense; TTTGGTGCGACCAGCTAGAGGTAAA
>probe:Drosophila_2:1625879_at:354:163; Interrogation_Position=662; Antisense; AAATTCACCATTTCTTTGAGCCAAA
>probe:Drosophila_2:1625879_at:478:415; Interrogation_Position=679; Antisense; GAGCCAAATTTATTCGTATTTCGTT
>probe:Drosophila_2:1625879_at:616:481; Interrogation_Position=694; Antisense; GTATTTCGTTTGTTTAACTCCACAT
>probe:Drosophila_2:1625879_at:601:465; Interrogation_Position=798; Antisense; GTTGTTGTACTGAGGAGATTCGTTA
>probe:Drosophila_2:1625879_at:40:429; Interrogation_Position=838; Antisense; GAGATATGCGTTGACATCATTCATT
>probe:Drosophila_2:1625879_at:170:195; Interrogation_Position=936; Antisense; AACTGAATTGTAAACGGAGGGCGCA
>probe:Drosophila_2:1625879_at:551:549; Interrogation_Position=951; Antisense; GGAGGGCGCATTTCAACTTATACAA

Paste this into a BLAST search page for me
AAAACGCATTACATTCCTCAAGCAAATTCCTCAAGCAAAACACGTCTAATGGAGAAATCTCTGGGAATTTACCAACAATAAGTCCCTGCAAATGAAGTTGTGAAGTTGCTAAATGCCTGGCATTCTGGCATTCAGCCTTTAAACTCTAAGTTTGGTGCGACCAGCTAGAGGTAAAAAATTCACCATTTCTTTGAGCCAAAGAGCCAAATTTATTCGTATTTCGTTGTATTTCGTTTGTTTAACTCCACATGTTGTTGTACTGAGGAGATTCGTTAGAGATATGCGTTGACATCATTCATTAACTGAATTGTAAACGGAGGGCGCAGGAGGGCGCATTTCAACTTATACAA

Full Affymetrix probeset data:

Annotations for 1625879_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720