Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625881_at:

>probe:Drosophila_2:1625881_at:73:575; Interrogation_Position=2851; Antisense; GGCGGACCCATTCTCGGCAAGCTAT
>probe:Drosophila_2:1625881_at:321:565; Interrogation_Position=2866; Antisense; GGCAAGCTATCGCTGGCCAAACGGA
>probe:Drosophila_2:1625881_at:62:159; Interrogation_Position=2892; Antisense; ACACAATGCCCTATCCAAGGCGGAA
>probe:Drosophila_2:1625881_at:101:397; Interrogation_Position=2914; Antisense; GAAATTCGACGGGATCAGCAGGGAT
>probe:Drosophila_2:1625881_at:592:349; Interrogation_Position=2931; Antisense; GCAGGGATTCGAGGGTCACAGCCAT
>probe:Drosophila_2:1625881_at:594:155; Interrogation_Position=2948; Antisense; ACAGCCATGGACAGTTTCAGCCCAT
>probe:Drosophila_2:1625881_at:181:315; Interrogation_Position=2996; Antisense; GCCTGGATGTGGACACGGGCTTCCA
>probe:Drosophila_2:1625881_at:656:155; Interrogation_Position=3104; Antisense; ACAGCGAGGATATACCCACGGCGGA
>probe:Drosophila_2:1625881_at:297:535; Interrogation_Position=3132; Antisense; GGTGCACGCCACTATGAAGCAGTTT
>probe:Drosophila_2:1625881_at:313:377; Interrogation_Position=3147; Antisense; GAAGCAGTTTCACCTGCGCAAGTGC
>probe:Drosophila_2:1625881_at:635:183; Interrogation_Position=3205; Antisense; AAAAGTGCTCGTGTTCGTCGCCGAA
>probe:Drosophila_2:1625881_at:582:389; Interrogation_Position=3227; Antisense; GAAACAAAGTTTCGCCGGAGCAAAG
>probe:Drosophila_2:1625881_at:691:443; Interrogation_Position=3253; Antisense; GATGATCCGGACGAGCGCAGCCAGC
>probe:Drosophila_2:1625881_at:722:561; Interrogation_Position=3327; Antisense; GGAACCATGGAGCACCCGCGAACTG

Paste this into a BLAST search page for me
GGCGGACCCATTCTCGGCAAGCTATGGCAAGCTATCGCTGGCCAAACGGAACACAATGCCCTATCCAAGGCGGAAGAAATTCGACGGGATCAGCAGGGATGCAGGGATTCGAGGGTCACAGCCATACAGCCATGGACAGTTTCAGCCCATGCCTGGATGTGGACACGGGCTTCCAACAGCGAGGATATACCCACGGCGGAGGTGCACGCCACTATGAAGCAGTTTGAAGCAGTTTCACCTGCGCAAGTGCAAAAGTGCTCGTGTTCGTCGCCGAAGAAACAAAGTTTCGCCGGAGCAAAGGATGATCCGGACGAGCGCAGCCAGCGGAACCATGGAGCACCCGCGAACTG

Full Affymetrix probeset data:

Annotations for 1625881_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime