FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625883_at:

>probe:Drosophila_2:1625883_at:171:555; Interrogation_Position=128; Antisense; GGACCACGGCACTACTATAGCGAAT
>probe:Drosophila_2:1625883_at:283:507; Interrogation_Position=165; Antisense; GTGCTAGTCCTAAACGTCTATCGTT
>probe:Drosophila_2:1625883_at:727:189; Interrogation_Position=204; Antisense; AACATGCAAATTGCCTGCGCCGGAC
>probe:Drosophila_2:1625883_at:192:349; Interrogation_Position=231; Antisense; GCAGTCGAATCCAGGGCCAGAATCC
>probe:Drosophila_2:1625883_at:163:381; Interrogation_Position=308; Antisense; GAACGCAAACGCACCGTAGAGCCAG
>probe:Drosophila_2:1625883_at:730:545; Interrogation_Position=417; Antisense; GGATGTACGCACAAGGTCGTCGCAG
>probe:Drosophila_2:1625883_at:122:209; Interrogation_Position=490; Antisense; AAGCTTCCGCTTAGGATGCGCTCGA
>probe:Drosophila_2:1625883_at:370:561; Interrogation_Position=517; Antisense; GGAAGTTATTTTGGCCGCCTGAACG
>probe:Drosophila_2:1625883_at:701:335; Interrogation_Position=549; Antisense; GCTGCTCATCTACTTGTGGTGCTAT
>probe:Drosophila_2:1625883_at:267:595; Interrogation_Position=563; Antisense; TGTGGTGCTATCTGCTACTGGTTAT
>probe:Drosophila_2:1625883_at:549:705; Interrogation_Position=584; Antisense; TTATGGCAGCATCTGGCGGCAGCAA
>probe:Drosophila_2:1625883_at:677:357; Interrogation_Position=605; Antisense; GCAACCACGTGGTAAATGGCCTCAA
>probe:Drosophila_2:1625883_at:636:405; Interrogation_Position=673; Antisense; GACTGCCCCGGAAAAGGACTTATGC
>probe:Drosophila_2:1625883_at:337:403; Interrogation_Position=689; Antisense; GACTTATGCTGTGGGATCCATGCAA

Paste this into a BLAST search page for me
GGACCACGGCACTACTATAGCGAATGTGCTAGTCCTAAACGTCTATCGTTAACATGCAAATTGCCTGCGCCGGACGCAGTCGAATCCAGGGCCAGAATCCGAACGCAAACGCACCGTAGAGCCAGGGATGTACGCACAAGGTCGTCGCAGAAGCTTCCGCTTAGGATGCGCTCGAGGAAGTTATTTTGGCCGCCTGAACGGCTGCTCATCTACTTGTGGTGCTATTGTGGTGCTATCTGCTACTGGTTATTTATGGCAGCATCTGGCGGCAGCAAGCAACCACGTGGTAAATGGCCTCAAGACTGCCCCGGAAAAGGACTTATGCGACTTATGCTGTGGGATCCATGCAA

Full Affymetrix probeset data:

Annotations for 1625883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720