FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625884_at:

>probe:Drosophila_2:1625884_at:547:623; Interrogation_Position=104; Antisense; TGCGCAAGGTGCCAGTGGTCTACTC
>probe:Drosophila_2:1625884_at:372:541; Interrogation_Position=135; Antisense; GGTTGTTCATGCTGCCCCAGTGGTA
>probe:Drosophila_2:1625884_at:158:303; Interrogation_Position=164; Antisense; CCGCTCCTCTGGTCAAGACTGTGAT
>probe:Drosophila_2:1625884_at:622:639; Interrogation_Position=171; Antisense; TCTGGTCAAGACTGTGATCCCTGCC
>probe:Drosophila_2:1625884_at:349:163; Interrogation_Position=19; Antisense; AAATTCCCGGCGATTCTTGCCAAGA
>probe:Drosophila_2:1625884_at:329:301; Interrogation_Position=201; Antisense; CCTGGTCAAGACTGTGATCCCTGCC
>probe:Drosophila_2:1625884_at:502:335; Interrogation_Position=226; Antisense; GCTCCCGTCCTTAAGACTGTGGTCT
>probe:Drosophila_2:1625884_at:285:709; Interrogation_Position=236; Antisense; TTAAGACTGTGGTCTCCTCTGCTCC
>probe:Drosophila_2:1625884_at:216:591; Interrogation_Position=293; Antisense; TGGTCAAGACCGTCATCCCAGCTGC
>probe:Drosophila_2:1625884_at:195:45; Interrogation_Position=307; Antisense; ATCCCAGCTGCTCCGGTTATCAAGA
>probe:Drosophila_2:1625884_at:490:11; Interrogation_Position=31; Antisense; ATTCTTGCCAAGACTGCCTACGTGG
>probe:Drosophila_2:1625884_at:186:475; Interrogation_Position=322; Antisense; GTTATCAAGACCGTGATCCCAGCTG
>probe:Drosophila_2:1625884_at:73:211; Interrogation_Position=40; Antisense; AAGACTGCCTACGTGGACACCAGCG
>probe:Drosophila_2:1625884_at:62:103; Interrogation_Position=86; Antisense; AGAGCAACGTGAACCTGGTGCGCAA

Paste this into a BLAST search page for me
TGCGCAAGGTGCCAGTGGTCTACTCGGTTGTTCATGCTGCCCCAGTGGTACCGCTCCTCTGGTCAAGACTGTGATTCTGGTCAAGACTGTGATCCCTGCCAAATTCCCGGCGATTCTTGCCAAGACCTGGTCAAGACTGTGATCCCTGCCGCTCCCGTCCTTAAGACTGTGGTCTTTAAGACTGTGGTCTCCTCTGCTCCTGGTCAAGACCGTCATCCCAGCTGCATCCCAGCTGCTCCGGTTATCAAGAATTCTTGCCAAGACTGCCTACGTGGGTTATCAAGACCGTGATCCCAGCTGAAGACTGCCTACGTGGACACCAGCGAGAGCAACGTGAACCTGGTGCGCAA

Full Affymetrix probeset data:

Annotations for 1625884_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720