Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625885_at:

>probe:Drosophila_2:1625885_at:590:625; Interrogation_Position=1304; Antisense; TGCCAAAAACATGATGACCGCCTGT
>probe:Drosophila_2:1625885_at:689:265; Interrogation_Position=1404; Antisense; CAGATGTACAACGTGCAGAGCAAGA
>probe:Drosophila_2:1625885_at:466:351; Interrogation_Position=1432; Antisense; GCAGCTACTTTGTCGAATGGATTCC
>probe:Drosophila_2:1625885_at:643:227; Interrogation_Position=1447; Antisense; AATGGATTCCCAACAACGTCAAGGT
>probe:Drosophila_2:1625885_at:711:493; Interrogation_Position=1464; Antisense; GTCAAGGTGGCCGTCTGCGACATCC
>probe:Drosophila_2:1625885_at:213:637; Interrogation_Position=1530; Antisense; TCGACCGCCATCCAGGAGATCTTTA
>probe:Drosophila_2:1625885_at:386:551; Interrogation_Position=1544; Antisense; GGAGATCTTTAAGCGCATCTCCGAG
>probe:Drosophila_2:1625885_at:564:381; Interrogation_Position=1664; Antisense; GAACGATCTGATATCCGAGTACCAA
>probe:Drosophila_2:1625885_at:47:339; Interrogation_Position=1701; Antisense; GCTACCGCCGACGACGAAGTGGAGT
>probe:Drosophila_2:1625885_at:711:93; Interrogation_Position=1723; Antisense; AGTTCGATGACGAGCAGGCCGAGCA
>probe:Drosophila_2:1625885_at:212:279; Interrogation_Position=1754; Antisense; CTACGAGTCGGAGGTCCTGCAGAAC
>probe:Drosophila_2:1625885_at:618:173; Interrogation_Position=1776; Antisense; AACGGCAATGGCGAGTAAAGTCCTA
>probe:Drosophila_2:1625885_at:130:505; Interrogation_Position=1795; Antisense; GTCCTAGAAACTATCACAACTGTAG
>probe:Drosophila_2:1625885_at:130:255; Interrogation_Position=1811; Antisense; CAACTGTAGCTGTTTTCTGTATACT

Paste this into a BLAST search page for me
TGCCAAAAACATGATGACCGCCTGTCAGATGTACAACGTGCAGAGCAAGAGCAGCTACTTTGTCGAATGGATTCCAATGGATTCCCAACAACGTCAAGGTGTCAAGGTGGCCGTCTGCGACATCCTCGACCGCCATCCAGGAGATCTTTAGGAGATCTTTAAGCGCATCTCCGAGGAACGATCTGATATCCGAGTACCAAGCTACCGCCGACGACGAAGTGGAGTAGTTCGATGACGAGCAGGCCGAGCACTACGAGTCGGAGGTCCTGCAGAACAACGGCAATGGCGAGTAAAGTCCTAGTCCTAGAAACTATCACAACTGTAGCAACTGTAGCTGTTTTCTGTATACT

Full Affymetrix probeset data:

Annotations for 1625885_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime