Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625886_s_at:

>probe:Drosophila_2:1625886_s_at:595:557; Interrogation_Position=105; Antisense; GGACATATCGCATCAGATCGACCCG
>probe:Drosophila_2:1625886_s_at:342:447; Interrogation_Position=120; Antisense; GATCGACCCGAATGGCGACCAATAA
>probe:Drosophila_2:1625886_s_at:547:247; Interrogation_Position=139; Antisense; CAATAATGAATCGTTGGCCGGTGGT
>probe:Drosophila_2:1625886_s_at:416:317; Interrogation_Position=155; Antisense; GCCGGTGGTGAAACGCATTTGGAAC
>probe:Drosophila_2:1625886_s_at:386:351; Interrogation_Position=17; Antisense; GCAGCAAATTGCGAATGCCACCATT
>probe:Drosophila_2:1625886_s_at:385:271; Interrogation_Position=232; Antisense; CATTCCACAGGATCTTGAGGGCGAG
>probe:Drosophila_2:1625886_s_at:304:369; Interrogation_Position=29; Antisense; GAATGCCACCATTACTCATACTTGT
>probe:Drosophila_2:1625886_s_at:392:661; Interrogation_Position=295; Antisense; TAAACTCGAGCCATATTCGGTGCCG
>probe:Drosophila_2:1625886_s_at:67:507; Interrogation_Position=314; Antisense; GTGCCGCGTACAGTAGTCTACCATA
>probe:Drosophila_2:1625886_s_at:341:457; Interrogation_Position=359; Antisense; GATATCGTTATGTCATCAGCGGCAA
>probe:Drosophila_2:1625886_s_at:499:421; Interrogation_Position=429; Antisense; GAGCACAGACATTTACGTACAACAA
>probe:Drosophila_2:1625886_s_at:514:221; Interrogation_Position=452; Antisense; AAGTGTCTATTGAGCCCCGATGGAT
>probe:Drosophila_2:1625886_s_at:568:29; Interrogation_Position=46; Antisense; ATACTTGTGATGTGCTGCGATTCGA
>probe:Drosophila_2:1625886_s_at:131:65; Interrogation_Position=471; Antisense; ATGGATTTCCCACATATCTGCCCGA

Paste this into a BLAST search page for me
GGACATATCGCATCAGATCGACCCGGATCGACCCGAATGGCGACCAATAACAATAATGAATCGTTGGCCGGTGGTGCCGGTGGTGAAACGCATTTGGAACGCAGCAAATTGCGAATGCCACCATTCATTCCACAGGATCTTGAGGGCGAGGAATGCCACCATTACTCATACTTGTTAAACTCGAGCCATATTCGGTGCCGGTGCCGCGTACAGTAGTCTACCATAGATATCGTTATGTCATCAGCGGCAAGAGCACAGACATTTACGTACAACAAAAGTGTCTATTGAGCCCCGATGGATATACTTGTGATGTGCTGCGATTCGAATGGATTTCCCACATATCTGCCCGA

Full Affymetrix probeset data:

Annotations for 1625886_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime