FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625887_at:

>probe:Drosophila_2:1625887_at:730:265; Interrogation_Position=4514; Antisense; CTAGAACAAGCCTCTGGCTCGGGAT
>probe:Drosophila_2:1625887_at:196:383; Interrogation_Position=4559; Antisense; GAACTGGCACCGGATCACGAACTAA
>probe:Drosophila_2:1625887_at:239:431; Interrogation_Position=4586; Antisense; GAGTACATTATCAAACGCATTCGCA
>probe:Drosophila_2:1625887_at:258:231; Interrogation_Position=4637; Antisense; AATGACTCCCTACTGGCAGAGGTAT
>probe:Drosophila_2:1625887_at:288:79; Interrogation_Position=4656; Antisense; AGGTATCAAAGCTGACGGCCACTGC
>probe:Drosophila_2:1625887_at:707:243; Interrogation_Position=4711; Antisense; AATTTCGCCCAAACGCATATATGCC
>probe:Drosophila_2:1625887_at:171:67; Interrogation_Position=4748; Antisense; ATGGACATACCACGACAGCGGGACG
>probe:Drosophila_2:1625887_at:196:121; Interrogation_Position=4764; Antisense; AGCGGGACGAGTTCCTGCTTTGGTA
>probe:Drosophila_2:1625887_at:65:489; Interrogation_Position=4786; Antisense; GTACCGTTCTTATTTGGAGCAGCTG
>probe:Drosophila_2:1625887_at:451:223; Interrogation_Position=4853; Antisense; AAGGTGACACCTTCTGGAGCCAGTC
>probe:Drosophila_2:1625887_at:353:127; Interrogation_Position=4870; Antisense; AGCCAGTCCGGCCAAGCTGAAGAAC
>probe:Drosophila_2:1625887_at:424:121; Interrogation_Position=4896; Antisense; AGCGTGTGCGCAAACAGTCCCAATC
>probe:Drosophila_2:1625887_at:620:31; Interrogation_Position=4938; Antisense; ATAACGATGCAGACTTGGCCGAGGC
>probe:Drosophila_2:1625887_at:210:211; Interrogation_Position=4970; Antisense; AAGAACGTCTCCTCCGCGGGAAATG

Paste this into a BLAST search page for me
CTAGAACAAGCCTCTGGCTCGGGATGAACTGGCACCGGATCACGAACTAAGAGTACATTATCAAACGCATTCGCAAATGACTCCCTACTGGCAGAGGTATAGGTATCAAAGCTGACGGCCACTGCAATTTCGCCCAAACGCATATATGCCATGGACATACCACGACAGCGGGACGAGCGGGACGAGTTCCTGCTTTGGTAGTACCGTTCTTATTTGGAGCAGCTGAAGGTGACACCTTCTGGAGCCAGTCAGCCAGTCCGGCCAAGCTGAAGAACAGCGTGTGCGCAAACAGTCCCAATCATAACGATGCAGACTTGGCCGAGGCAAGAACGTCTCCTCCGCGGGAAATG

Full Affymetrix probeset data:

Annotations for 1625887_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720