FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625889_at:

>probe:Drosophila_2:1625889_at:700:383; Interrogation_Position=375; Antisense; GAACTGTTCTTCGATCAGCTTGCTG
>probe:Drosophila_2:1625889_at:653:423; Interrogation_Position=401; Antisense; GAGAGCTTTTCAAATCGCTAAACGT
>probe:Drosophila_2:1625889_at:289:279; Interrogation_Position=418; Antisense; CTAAACGTTGTGTGAGCTGTCAGGT
>probe:Drosophila_2:1625889_at:103:419; Interrogation_Position=431; Antisense; GAGCTGTCAGGTTAATCTTGATCAT
>probe:Drosophila_2:1625889_at:653:157; Interrogation_Position=463; Antisense; ACAAGCAAGCCCCTGGTTAATTGAA
>probe:Drosophila_2:1625889_at:477:247; Interrogation_Position=487; Antisense; AATTGCCTGACGAGTGAGCATGACA
>probe:Drosophila_2:1625889_at:326:397; Interrogation_Position=508; Antisense; GACAAGGAAGACTGCATCTCCGCTC
>probe:Drosophila_2:1625889_at:507:337; Interrogation_Position=529; Antisense; GCTCGCCATTCGTTTGCGATGAGGC
>probe:Drosophila_2:1625889_at:197:445; Interrogation_Position=546; Antisense; GATGAGGCGCACTTCCTGTTCTATC
>probe:Drosophila_2:1625889_at:122:187; Interrogation_Position=583; Antisense; AACAGCGCGGCTAAGAAGTTGGAGT
>probe:Drosophila_2:1625889_at:17:217; Interrogation_Position=598; Antisense; AAGTTGGAGTTGTTGCGACACCCCA
>probe:Drosophila_2:1625889_at:677:467; Interrogation_Position=609; Antisense; GTTGCGACACCCCAATGGATTGCTA
>probe:Drosophila_2:1625889_at:218:543; Interrogation_Position=625; Antisense; GGATTGCTACATTACGCTCGTTTCT
>probe:Drosophila_2:1625889_at:80:191; Interrogation_Position=665; Antisense; AACTTGACCATCGTCCATATCAGGT

Paste this into a BLAST search page for me
GAACTGTTCTTCGATCAGCTTGCTGGAGAGCTTTTCAAATCGCTAAACGTCTAAACGTTGTGTGAGCTGTCAGGTGAGCTGTCAGGTTAATCTTGATCATACAAGCAAGCCCCTGGTTAATTGAAAATTGCCTGACGAGTGAGCATGACAGACAAGGAAGACTGCATCTCCGCTCGCTCGCCATTCGTTTGCGATGAGGCGATGAGGCGCACTTCCTGTTCTATCAACAGCGCGGCTAAGAAGTTGGAGTAAGTTGGAGTTGTTGCGACACCCCAGTTGCGACACCCCAATGGATTGCTAGGATTGCTACATTACGCTCGTTTCTAACTTGACCATCGTCCATATCAGGT

Full Affymetrix probeset data:

Annotations for 1625889_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720