FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625891_at:

>probe:Drosophila_2:1625891_at:342:489; Interrogation_Position=1723; Antisense; GTACACACAGCCAGCAGGAGCATGT
>probe:Drosophila_2:1625891_at:115:197; Interrogation_Position=1782; Antisense; AACGGCCAACGTAAGCTTCGATGTA
>probe:Drosophila_2:1625891_at:6:173; Interrogation_Position=1806; Antisense; AAAGATTCGCTTCTGCGTGGAGCGC
>probe:Drosophila_2:1625891_at:13:727; Interrogation_Position=1845; Antisense; TTGTATTAGTTCATCCTGGCAACGG
>probe:Drosophila_2:1625891_at:437:227; Interrogation_Position=1872; Antisense; AAGGCGACAGGCTGACCAACCAGAT
>probe:Drosophila_2:1625891_at:30:375; Interrogation_Position=1906; Antisense; GAAGACCTACGAGTTCAGAACCCCG
>probe:Drosophila_2:1625891_at:28:73; Interrogation_Position=1991; Antisense; AGGAATTGCCCCTCAACTACAATAT
>probe:Drosophila_2:1625891_at:30:241; Interrogation_Position=2047; Antisense; AATAGTTATCTGTACGGCGAGCGGG
>probe:Drosophila_2:1625891_at:214:657; Interrogation_Position=2115; Antisense; TAACGTTTGCATCAACCAGAGCCTG
>probe:Drosophila_2:1625891_at:19:335; Interrogation_Position=2139; Antisense; GCTGATTGCACTGTTCATCTTCTGG
>probe:Drosophila_2:1625891_at:491:271; Interrogation_Position=2154; Antisense; CATCTTCTGGCTGATCTGTCAAGTT
>probe:Drosophila_2:1625891_at:26:645; Interrogation_Position=2186; Antisense; TCTTCGGCTGTGGAATGGTGCTGCA
>probe:Drosophila_2:1625891_at:246:411; Interrogation_Position=2246; Antisense; GACGCAGGCTGCACGAGGAGTACCT
>probe:Drosophila_2:1625891_at:42:545; Interrogation_Position=2295; Antisense; GGATCAAGGCGGATACACACTCTAA

Paste this into a BLAST search page for me
GTACACACAGCCAGCAGGAGCATGTAACGGCCAACGTAAGCTTCGATGTAAAAGATTCGCTTCTGCGTGGAGCGCTTGTATTAGTTCATCCTGGCAACGGAAGGCGACAGGCTGACCAACCAGATGAAGACCTACGAGTTCAGAACCCCGAGGAATTGCCCCTCAACTACAATATAATAGTTATCTGTACGGCGAGCGGGTAACGTTTGCATCAACCAGAGCCTGGCTGATTGCACTGTTCATCTTCTGGCATCTTCTGGCTGATCTGTCAAGTTTCTTCGGCTGTGGAATGGTGCTGCAGACGCAGGCTGCACGAGGAGTACCTGGATCAAGGCGGATACACACTCTAA

Full Affymetrix probeset data:

Annotations for 1625891_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720