FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625894_at:

>probe:Drosophila_2:1625894_at:26:585; Interrogation_Position=1030; Antisense; TGGCACCTTTTTCCCAATCGATTTC
>probe:Drosophila_2:1625894_at:345:235; Interrogation_Position=1045; Antisense; AATCGATTTCGGAGGCACCAACGGC
>probe:Drosophila_2:1625894_at:289:9; Interrogation_Position=1076; Antisense; ATTGCCATTGCCAACTCTTTCAGCA
>probe:Drosophila_2:1625894_at:248:361; Interrogation_Position=1185; Antisense; GCAAGTTCCGCCACTAATCCTTGAA
>probe:Drosophila_2:1625894_at:439:233; Interrogation_Position=1200; Antisense; AATCCTTGAACCACACCTTGATGGC
>probe:Drosophila_2:1625894_at:331:69; Interrogation_Position=1220; Antisense; ATGGCGCCAGCAACTGCGAGGGCAC
>probe:Drosophila_2:1625894_at:45:435; Interrogation_Position=1237; Antisense; GAGGGCACCCGAATCAAATCAGTCT
>probe:Drosophila_2:1625894_at:207:239; Interrogation_Position=1253; Antisense; AATCAGTCTAAAACGATTCTCCTGT
>probe:Drosophila_2:1625894_at:48:137; Interrogation_Position=1265; Antisense; ACGATTCTCCTGTAATTATTAGCAA
>probe:Drosophila_2:1625894_at:697:357; Interrogation_Position=1286; Antisense; GCAAATTTGTCAATCTTTGAGCGCA
>probe:Drosophila_2:1625894_at:293:211; Interrogation_Position=782; Antisense; AAGAAGGTGATCGTCGAGCTGGATC
>probe:Drosophila_2:1625894_at:587:299; Interrogation_Position=829; Antisense; CGCCGCCATTGAAGACGAGGAGGAA
>probe:Drosophila_2:1625894_at:118:437; Interrogation_Position=893; Antisense; GAGGAGCTGTCCGTGCCCGTAAAAC
>probe:Drosophila_2:1625894_at:138:379; Interrogation_Position=964; Antisense; GAAGCCTGTGAAGGCTGCTTCTCCT

Paste this into a BLAST search page for me
TGGCACCTTTTTCCCAATCGATTTCAATCGATTTCGGAGGCACCAACGGCATTGCCATTGCCAACTCTTTCAGCAGCAAGTTCCGCCACTAATCCTTGAAAATCCTTGAACCACACCTTGATGGCATGGCGCCAGCAACTGCGAGGGCACGAGGGCACCCGAATCAAATCAGTCTAATCAGTCTAAAACGATTCTCCTGTACGATTCTCCTGTAATTATTAGCAAGCAAATTTGTCAATCTTTGAGCGCAAAGAAGGTGATCGTCGAGCTGGATCCGCCGCCATTGAAGACGAGGAGGAAGAGGAGCTGTCCGTGCCCGTAAAACGAAGCCTGTGAAGGCTGCTTCTCCT

Full Affymetrix probeset data:

Annotations for 1625894_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720