FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625900_at:

>probe:Drosophila_2:1625900_at:626:235; Interrogation_Position=255; Antisense; AATCCGATCTCTTGATAGCTGTCAC
>probe:Drosophila_2:1625900_at:388:133; Interrogation_Position=278; Antisense; ACCCACTTTCTGATCACCAAGGAGT
>probe:Drosophila_2:1625900_at:319:323; Interrogation_Position=315; Antisense; GCGCCATCAATTATTCAGCATCCGA
>probe:Drosophila_2:1625900_at:673:383; Interrogation_Position=366; Antisense; GAACTGTGTGTGAGCAGCTGCCCGA
>probe:Drosophila_2:1625900_at:221:49; Interrogation_Position=405; Antisense; ATGCCGATCGATACACTCTGAACTA
>probe:Drosophila_2:1625900_at:187:383; Interrogation_Position=424; Antisense; GAACTACACGGATGGTCTGGCCGGT
>probe:Drosophila_2:1625900_at:426:305; Interrogation_Position=444; Antisense; CCGGTCAGTATATCCTTATGGCCAA
>probe:Drosophila_2:1625900_at:64:177; Interrogation_Position=515; Antisense; AAACGAATGGCCATCGTCTGTCTGC
>probe:Drosophila_2:1625900_at:589:615; Interrogation_Position=537; Antisense; TGCAGCCGGAGCATCTCGTGAATTC
>probe:Drosophila_2:1625900_at:150:363; Interrogation_Position=556; Antisense; GAATTCCACCTGTAAGTCATCGATG
>probe:Drosophila_2:1625900_at:66:105; Interrogation_Position=617; Antisense; AGACTGCGTGCCGAACTGGTGGATC
>probe:Drosophila_2:1625900_at:504:419; Interrogation_Position=710; Antisense; GAGCTACCTGTACGAAATTCTGGCA
>probe:Drosophila_2:1625900_at:695:677; Interrogation_Position=739; Antisense; TAGAGTGGCCTTCAACATCGTCGAA
>probe:Drosophila_2:1625900_at:164:355; Interrogation_Position=765; Antisense; GCACCCATTCGCTGGAGTCTTAAAA

Paste this into a BLAST search page for me
AATCCGATCTCTTGATAGCTGTCACACCCACTTTCTGATCACCAAGGAGTGCGCCATCAATTATTCAGCATCCGAGAACTGTGTGTGAGCAGCTGCCCGAATGCCGATCGATACACTCTGAACTAGAACTACACGGATGGTCTGGCCGGTCCGGTCAGTATATCCTTATGGCCAAAAACGAATGGCCATCGTCTGTCTGCTGCAGCCGGAGCATCTCGTGAATTCGAATTCCACCTGTAAGTCATCGATGAGACTGCGTGCCGAACTGGTGGATCGAGCTACCTGTACGAAATTCTGGCATAGAGTGGCCTTCAACATCGTCGAAGCACCCATTCGCTGGAGTCTTAAAA

Full Affymetrix probeset data:

Annotations for 1625900_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720