Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625902_at:

>probe:Drosophila_2:1625902_at:235:687; Interrogation_Position=1123; Antisense; TATTTGTTCTCCTGGCAGATCGTCG
>probe:Drosophila_2:1625902_at:454:97; Interrogation_Position=1139; Antisense; AGATCGTCGTCGCTGGCATGGCTCT
>probe:Drosophila_2:1625902_at:220:69; Interrogation_Position=1156; Antisense; ATGGCTCTGCCTGGTCTGGGCTACA
>probe:Drosophila_2:1625902_at:333:105; Interrogation_Position=1247; Antisense; AGACGGGCATCCAGAACACGGGCAT
>probe:Drosophila_2:1625902_at:469:719; Interrogation_Position=1279; Antisense; TTCCTGCTGACGACCACGCTGGAAT
>probe:Drosophila_2:1625902_at:512:625; Interrogation_Position=1331; Antisense; TGCCCGTATCGGTGGCCGTGATGAC
>probe:Drosophila_2:1625902_at:617:301; Interrogation_Position=1364; Antisense; CCCTGCTGGGCATTTATCTGTACAA
>probe:Drosophila_2:1625902_at:276:17; Interrogation_Position=1375; Antisense; ATTTATCTGTACAACCGGTGCTGGG
>probe:Drosophila_2:1625902_at:210:123; Interrogation_Position=1406; Antisense; AGCGAATTAGTGAGGCCAGCGCCAC
>probe:Drosophila_2:1625902_at:520:521; Interrogation_Position=1457; Antisense; GGGCGATACATTAGCATTACCATGG
>probe:Drosophila_2:1625902_at:566:659; Interrogation_Position=1535; Antisense; TAACCTATACATCGTGCTAGCGCAC
>probe:Drosophila_2:1625902_at:111:593; Interrogation_Position=1593; Antisense; TGGGACCAAGGAATGCCGCAAATCT
>probe:Drosophila_2:1625902_at:592:319; Interrogation_Position=1607; Antisense; GCCGCAAATCTCAAGCGTATTATAC
>probe:Drosophila_2:1625902_at:571:363; Interrogation_Position=1636; Antisense; GAATTTCACCTAACACCTAAGACGA

Paste this into a BLAST search page for me
TATTTGTTCTCCTGGCAGATCGTCGAGATCGTCGTCGCTGGCATGGCTCTATGGCTCTGCCTGGTCTGGGCTACAAGACGGGCATCCAGAACACGGGCATTTCCTGCTGACGACCACGCTGGAATTGCCCGTATCGGTGGCCGTGATGACCCCTGCTGGGCATTTATCTGTACAAATTTATCTGTACAACCGGTGCTGGGAGCGAATTAGTGAGGCCAGCGCCACGGGCGATACATTAGCATTACCATGGTAACCTATACATCGTGCTAGCGCACTGGGACCAAGGAATGCCGCAAATCTGCCGCAAATCTCAAGCGTATTATACGAATTTCACCTAACACCTAAGACGA

Full Affymetrix probeset data:

Annotations for 1625902_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime