FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625903_at:

>probe:Drosophila_2:1625903_at:93:553; Interrogation_Position=1496; Antisense; GGAGCATTGTCAACCTGCAGGCACT
>probe:Drosophila_2:1625903_at:490:263; Interrogation_Position=1527; Antisense; CAGCAACCTCGCGATTGGGATGGAA
>probe:Drosophila_2:1625903_at:332:545; Interrogation_Position=1676; Antisense; GGATAATCCAGGGACGCTTCGCATT
>probe:Drosophila_2:1625903_at:253:637; Interrogation_Position=1712; Antisense; TCGATCGTATGTACAGGTTGCTCCT
>probe:Drosophila_2:1625903_at:439:541; Interrogation_Position=1727; Antisense; GGTTGCTCCTGGAACTCCAAATGGA
>probe:Drosophila_2:1625903_at:622:57; Interrogation_Position=1751; Antisense; ATGAGGCGGAGTTCTGTGACCTGCA
>probe:Drosophila_2:1625903_at:166:549; Interrogation_Position=1776; Antisense; GGAGGTCATGTTCAACCTGCCATAC
>probe:Drosophila_2:1625903_at:585:625; Interrogation_Position=1793; Antisense; TGCCATACGACTCAGGATCCGTGAT
>probe:Drosophila_2:1625903_at:187:445; Interrogation_Position=1815; Antisense; GATGCCCAAGGGTTCTCCGTGGAGA
>probe:Drosophila_2:1625903_at:618:53; Interrogation_Position=1853; Antisense; ATGCACTGCTTCATTTTCGGGCTAC
>probe:Drosophila_2:1625903_at:714:463; Interrogation_Position=1924; Antisense; GATTGCAGCCTGTTTAAGACCTCGC
>probe:Drosophila_2:1625903_at:342:87; Interrogation_Position=2014; Antisense; AGTGCGCTGGTCTTTCTGCTGGAAC
>probe:Drosophila_2:1625903_at:474:139; Interrogation_Position=2048; Antisense; ACTGGCTACCGGACTTTCGAAGGAG
>probe:Drosophila_2:1625903_at:238:435; Interrogation_Position=2070; Antisense; GAGGTTGGGTACCATGTCCACTTAA

Paste this into a BLAST search page for me
GGAGCATTGTCAACCTGCAGGCACTCAGCAACCTCGCGATTGGGATGGAAGGATAATCCAGGGACGCTTCGCATTTCGATCGTATGTACAGGTTGCTCCTGGTTGCTCCTGGAACTCCAAATGGAATGAGGCGGAGTTCTGTGACCTGCAGGAGGTCATGTTCAACCTGCCATACTGCCATACGACTCAGGATCCGTGATGATGCCCAAGGGTTCTCCGTGGAGAATGCACTGCTTCATTTTCGGGCTACGATTGCAGCCTGTTTAAGACCTCGCAGTGCGCTGGTCTTTCTGCTGGAACACTGGCTACCGGACTTTCGAAGGAGGAGGTTGGGTACCATGTCCACTTAA

Full Affymetrix probeset data:

Annotations for 1625903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720