FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625904_at:

>probe:Drosophila_2:1625904_at:538:203; Interrogation_Position=415; Antisense; AAGCCGTCGACTATCTGTTGTTATC
>probe:Drosophila_2:1625904_at:157:727; Interrogation_Position=432; Antisense; TTGTTATCCCAAGCCAACGAGATGC
>probe:Drosophila_2:1625904_at:241:425; Interrogation_Position=450; Antisense; GAGATGCTGCGCCAGTCCAAAAGCT
>probe:Drosophila_2:1625904_at:87:679; Interrogation_Position=479; Antisense; TAGTGCCCTGCAGTCCAATGGATAC
>probe:Drosophila_2:1625904_at:678:65; Interrogation_Position=496; Antisense; ATGGATACTCCGAAATCTTCCTGCT
>probe:Drosophila_2:1625904_at:52:477; Interrogation_Position=569; Antisense; GTACTCCCAGGGTGGACTTCGATCA
>probe:Drosophila_2:1625904_at:665:281; Interrogation_Position=675; Antisense; CTCGGTGGCCTGTCAACAGCTGAAA
>probe:Drosophila_2:1625904_at:33:107; Interrogation_Position=699; Antisense; AGACAAGCTTACATCCCAGATTGCC
>probe:Drosophila_2:1625904_at:394:517; Interrogation_Position=750; Antisense; GTGGACCCGTTTGATTCGTGGCAAC
>probe:Drosophila_2:1625904_at:307:61; Interrogation_Position=812; Antisense; ATGTAGACAACTCTCCCTCTAAGAT
>probe:Drosophila_2:1625904_at:710:647; Interrogation_Position=854; Antisense; TCATCCTTTTTCTAGTCATGCCGAA
>probe:Drosophila_2:1625904_at:53:369; Interrogation_Position=876; Antisense; GAATGGTTGCATCATGCCCTTTGAG
>probe:Drosophila_2:1625904_at:405:319; Interrogation_Position=891; Antisense; GCCCTTTGAGTCTATTTGTGGTCCT
>probe:Drosophila_2:1625904_at:469:475; Interrogation_Position=937; Antisense; GTATACTTTTTAGCCTGTGGTCAGT

Paste this into a BLAST search page for me
AAGCCGTCGACTATCTGTTGTTATCTTGTTATCCCAAGCCAACGAGATGCGAGATGCTGCGCCAGTCCAAAAGCTTAGTGCCCTGCAGTCCAATGGATACATGGATACTCCGAAATCTTCCTGCTGTACTCCCAGGGTGGACTTCGATCACTCGGTGGCCTGTCAACAGCTGAAAAGACAAGCTTACATCCCAGATTGCCGTGGACCCGTTTGATTCGTGGCAACATGTAGACAACTCTCCCTCTAAGATTCATCCTTTTTCTAGTCATGCCGAAGAATGGTTGCATCATGCCCTTTGAGGCCCTTTGAGTCTATTTGTGGTCCTGTATACTTTTTAGCCTGTGGTCAGT

Full Affymetrix probeset data:

Annotations for 1625904_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720