FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625905_at:

>probe:Drosophila_2:1625905_at:253:659; Interrogation_Position=107; Antisense; TAGAATCCGTCAACTACCTGGTAGT
>probe:Drosophila_2:1625905_at:641:285; Interrogation_Position=124; Antisense; CTGGTAGTATTCCTCACCGGCGTAT
>probe:Drosophila_2:1625905_at:281:21; Interrogation_Position=178; Antisense; ATATATTTCAGCTGGCCGGACGCGA
>probe:Drosophila_2:1625905_at:578:687; Interrogation_Position=20; Antisense; TATTCGGTCTGATAGTCTCCGGACG
>probe:Drosophila_2:1625905_at:163:569; Interrogation_Position=218; Antisense; GGCAGTATCTGGGTCACATAAACAA
>probe:Drosophila_2:1625905_at:193:261; Interrogation_Position=304; Antisense; CAGGCTCACGGGATGGTCTTCGGCA
>probe:Drosophila_2:1625905_at:358:645; Interrogation_Position=320; Antisense; TCTTCGGCAGCCAGGAGATCTCACA
>probe:Drosophila_2:1625905_at:581:137; Interrogation_Position=351; Antisense; ACAGATTGGAGTTTCCCTCGAACCG
>probe:Drosophila_2:1625905_at:130:551; Interrogation_Position=375; Antisense; GGAGCTAACGGTGGCCCAACAGACG
>probe:Drosophila_2:1625905_at:507:585; Interrogation_Position=449; Antisense; TGGAGAACTTCTTCAACTACGCCTC
>probe:Drosophila_2:1625905_at:542:309; Interrogation_Position=473; Antisense; CCAGCTTCGGAGTGGCAGCCAGAGA
>probe:Drosophila_2:1625905_at:426:317; Interrogation_Position=48; Antisense; GCCCCAATCGGATTTTGTGGCCGTG
>probe:Drosophila_2:1625905_at:600:537; Interrogation_Position=551; Antisense; GGTATACGAATTTCCAGCGTCGCAT
>probe:Drosophila_2:1625905_at:129:217; Interrogation_Position=82; Antisense; AAGTTGCTCGTGAATGTGCCCGACA

Paste this into a BLAST search page for me
TAGAATCCGTCAACTACCTGGTAGTCTGGTAGTATTCCTCACCGGCGTATATATATTTCAGCTGGCCGGACGCGATATTCGGTCTGATAGTCTCCGGACGGGCAGTATCTGGGTCACATAAACAACAGGCTCACGGGATGGTCTTCGGCATCTTCGGCAGCCAGGAGATCTCACAACAGATTGGAGTTTCCCTCGAACCGGGAGCTAACGGTGGCCCAACAGACGTGGAGAACTTCTTCAACTACGCCTCCCAGCTTCGGAGTGGCAGCCAGAGAGCCCCAATCGGATTTTGTGGCCGTGGGTATACGAATTTCCAGCGTCGCATAAGTTGCTCGTGAATGTGCCCGACA

Full Affymetrix probeset data:

Annotations for 1625905_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720