FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625910_at:

>probe:Drosophila_2:1625910_at:166:227; Interrogation_Position=1033; Antisense; AATGTGTACGATCTAGTAGTCCATG
>probe:Drosophila_2:1625910_at:656:485; Interrogation_Position=1048; Antisense; GTAGTCCATGATTTTGTGTCGTTCA
>probe:Drosophila_2:1625910_at:107:517; Interrogation_Position=1063; Antisense; GTGTCGTTCATTTGTATAGCAAGTA
>probe:Drosophila_2:1625910_at:254:25; Interrogation_Position=573; Antisense; ATATGTCTACCCCTGACGGATGAAC
>probe:Drosophila_2:1625910_at:504:673; Interrogation_Position=580; Antisense; TACCCCTGACGGATGAACTCTTGGC
>probe:Drosophila_2:1625910_at:203:723; Interrogation_Position=612; Antisense; TTGCAGCTGGGACAATCCTACATGG
>probe:Drosophila_2:1625910_at:496:159; Interrogation_Position=623; Antisense; ACAATCCTACATGGCTGTGGGCTGG
>probe:Drosophila_2:1625910_at:644:107; Interrogation_Position=651; Antisense; AGAACGGAAAGTCGGCGCTTCGCCA
>probe:Drosophila_2:1625910_at:630:639; Interrogation_Position=662; Antisense; TCGGCGCTTCGCCAACAGTACAATG
>probe:Drosophila_2:1625910_at:707:63; Interrogation_Position=684; Antisense; ATGGAGGTCCATATAAACACTGAGA
>probe:Drosophila_2:1625910_at:398:275; Interrogation_Position=734; Antisense; CTTCCTTTGCGCCAATGGAGATTAT
>probe:Drosophila_2:1625910_at:295:63; Interrogation_Position=910; Antisense; ATGTGCCCTGGATACTCGCCAAGAT
>probe:Drosophila_2:1625910_at:20:301; Interrogation_Position=926; Antisense; CGCCAAGATGGCAGAATTATCGGAT
>probe:Drosophila_2:1625910_at:316:139; Interrogation_Position=975; Antisense; ACGTACTGGTGTTGATAATTTTCGA

Paste this into a BLAST search page for me
AATGTGTACGATCTAGTAGTCCATGGTAGTCCATGATTTTGTGTCGTTCAGTGTCGTTCATTTGTATAGCAAGTAATATGTCTACCCCTGACGGATGAACTACCCCTGACGGATGAACTCTTGGCTTGCAGCTGGGACAATCCTACATGGACAATCCTACATGGCTGTGGGCTGGAGAACGGAAAGTCGGCGCTTCGCCATCGGCGCTTCGCCAACAGTACAATGATGGAGGTCCATATAAACACTGAGACTTCCTTTGCGCCAATGGAGATTATATGTGCCCTGGATACTCGCCAAGATCGCCAAGATGGCAGAATTATCGGATACGTACTGGTGTTGATAATTTTCGA

Full Affymetrix probeset data:

Annotations for 1625910_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720