FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625911_at:

>probe:Drosophila_2:1625911_at:600:615; Interrogation_Position=1736; Antisense; TGAATCGTGGACGAGTTGCACGCAA
>probe:Drosophila_2:1625911_at:118:221; Interrogation_Position=1759; Antisense; AAGGGTTGGATCACCCGATCGGCAC
>probe:Drosophila_2:1625911_at:220:59; Interrogation_Position=1826; Antisense; ATGATAGTCCGCTGCTGCTTAACGA
>probe:Drosophila_2:1625911_at:311:421; Interrogation_Position=1849; Antisense; GAGCACGATGAGGATGCCATTGACG
>probe:Drosophila_2:1625911_at:43:295; Interrogation_Position=1902; Antisense; CGATCGCCAGCGGAATCATCAGGAG
>probe:Drosophila_2:1625911_at:549:531; Interrogation_Position=1935; Antisense; GGGTCATGAGGATACCGACAGCGAA
>probe:Drosophila_2:1625911_at:53:549; Interrogation_Position=1968; Antisense; GGAGGCCAGGAATCATCGTCGCCAG
>probe:Drosophila_2:1625911_at:678:307; Interrogation_Position=2019; Antisense; CCATCGGCGCGGACAACTTGAATAA
>probe:Drosophila_2:1625911_at:76:519; Interrogation_Position=2052; Antisense; GTGGTCGTTGGAATCGCCAGTGTCA
>probe:Drosophila_2:1625911_at:579:367; Interrogation_Position=2062; Antisense; GAATCGCCAGTGTCATTTAGTAGTT
>probe:Drosophila_2:1625911_at:508:723; Interrogation_Position=2088; Antisense; TTGTTGTAGCTCAAGGTTCTCCTTT
>probe:Drosophila_2:1625911_at:76:575; Interrogation_Position=2156; Antisense; GGCGGCACGCTTCTTAGTCTGAAGA
>probe:Drosophila_2:1625911_at:253:493; Interrogation_Position=2238; Antisense; GTAAGATTTCTATAGTGCGACACAC
>probe:Drosophila_2:1625911_at:670:395; Interrogation_Position=2278; Antisense; GAAATTTATCCTTTCTGGTCATTGG

Paste this into a BLAST search page for me
TGAATCGTGGACGAGTTGCACGCAAAAGGGTTGGATCACCCGATCGGCACATGATAGTCCGCTGCTGCTTAACGAGAGCACGATGAGGATGCCATTGACGCGATCGCCAGCGGAATCATCAGGAGGGGTCATGAGGATACCGACAGCGAAGGAGGCCAGGAATCATCGTCGCCAGCCATCGGCGCGGACAACTTGAATAAGTGGTCGTTGGAATCGCCAGTGTCAGAATCGCCAGTGTCATTTAGTAGTTTTGTTGTAGCTCAAGGTTCTCCTTTGGCGGCACGCTTCTTAGTCTGAAGAGTAAGATTTCTATAGTGCGACACACGAAATTTATCCTTTCTGGTCATTGG

Full Affymetrix probeset data:

Annotations for 1625911_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720