FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625913_at:

>probe:Drosophila_2:1625913_at:546:527; Interrogation_Position=1049; Antisense; GGGAGCACTTTCAGCGTCTGATGAA
>probe:Drosophila_2:1625913_at:696:499; Interrogation_Position=1064; Antisense; GTCTGATGAAGTGCGTCCGCTTTCA
>probe:Drosophila_2:1625913_at:224:297; Interrogation_Position=1081; Antisense; CGCTTTCACCATATGCCAATGACTT
>probe:Drosophila_2:1625913_at:567:55; Interrogation_Position=1099; Antisense; ATGACTTTTTTGTTTAGCCTGCGCG
>probe:Drosophila_2:1625913_at:285:431; Interrogation_Position=1123; Antisense; GAGTCTTTCAACCATCCGGAGAAGT
>probe:Drosophila_2:1625913_at:236:289; Interrogation_Position=1139; Antisense; CGGAGAAGTTTGACCTCTTTAGCAA
>probe:Drosophila_2:1625913_at:33:561; Interrogation_Position=1164; Antisense; GGAACCCGGGATGTTGGCATTCAAT
>probe:Drosophila_2:1625913_at:565:29; Interrogation_Position=1227; Antisense; ATACTTTATCAGTGTGCGCACCCAG
>probe:Drosophila_2:1625913_at:22:685; Interrogation_Position=1260; Antisense; TATCAACGAGTTTTTGTCCACCTGC
>probe:Drosophila_2:1625913_at:482:515; Interrogation_Position=1305; Antisense; GGTCTTACCACGTTGGTGGGTCTAT
>probe:Drosophila_2:1625913_at:670:529; Interrogation_Position=1322; Antisense; GGGTCTATCACGTCAATTGCCCGTT
>probe:Drosophila_2:1625913_at:494:575; Interrogation_Position=1402; Antisense; GGCGACTACATTGACAGCATCCAGA
>probe:Drosophila_2:1625913_at:529:169; Interrogation_Position=1461; Antisense; AAAGGACCTGGTTATCGACCTGGCT
>probe:Drosophila_2:1625913_at:696:695; Interrogation_Position=1573; Antisense; TTGTTTTCGAAGTGGGTCACCTCTT

Paste this into a BLAST search page for me
GGGAGCACTTTCAGCGTCTGATGAAGTCTGATGAAGTGCGTCCGCTTTCACGCTTTCACCATATGCCAATGACTTATGACTTTTTTGTTTAGCCTGCGCGGAGTCTTTCAACCATCCGGAGAAGTCGGAGAAGTTTGACCTCTTTAGCAAGGAACCCGGGATGTTGGCATTCAATATACTTTATCAGTGTGCGCACCCAGTATCAACGAGTTTTTGTCCACCTGCGGTCTTACCACGTTGGTGGGTCTATGGGTCTATCACGTCAATTGCCCGTTGGCGACTACATTGACAGCATCCAGAAAAGGACCTGGTTATCGACCTGGCTTTGTTTTCGAAGTGGGTCACCTCTT

Full Affymetrix probeset data:

Annotations for 1625913_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720