FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625914_at:

>probe:Drosophila_2:1625914_at:498:343; Interrogation_Position=483; Antisense; GCTTCTTTGGGAACACTTGCACGAG
>probe:Drosophila_2:1625914_at:257:63; Interrogation_Position=563; Antisense; ATGGGTCGGCACTTGGATTTGGTAT
>probe:Drosophila_2:1625914_at:435:29; Interrogation_Position=601; Antisense; ATAACCGTGGGATCCTTTGTGGGCG
>probe:Drosophila_2:1625914_at:154:679; Interrogation_Position=626; Antisense; TAGGTTTCAGTATTGTCACCCAGAA
>probe:Drosophila_2:1625914_at:473:91; Interrogation_Position=707; Antisense; AGTTAGTATCTCTCGATTGCCGTCG
>probe:Drosophila_2:1625914_at:320:9; Interrogation_Position=722; Antisense; ATTGCCGTCGTCCTGGAGCTCATAA
>probe:Drosophila_2:1625914_at:332:383; Interrogation_Position=816; Antisense; GAACTTTGTATTCGGCTCTAGCCTA
>probe:Drosophila_2:1625914_at:68:681; Interrogation_Position=842; Antisense; TAGGTGCCACTATTGCCATTTGTAT
>probe:Drosophila_2:1625914_at:542:513; Interrogation_Position=872; Antisense; GTGTTTCTATAATGCTACTGGACTT
>probe:Drosophila_2:1625914_at:142:669; Interrogation_Position=887; Antisense; TACTGGACTTAGCATCTGCCTTCAA
>probe:Drosophila_2:1625914_at:552:627; Interrogation_Position=903; Antisense; TGCCTTCAAATATGCCAGTGGTCTA
>probe:Drosophila_2:1625914_at:372:267; Interrogation_Position=918; Antisense; CAGTGGTCTAGTGGCATTCGTCCTC
>probe:Drosophila_2:1625914_at:405:9; Interrogation_Position=933; Antisense; ATTCGTCCTCTACAACTTTGTCATC
>probe:Drosophila_2:1625914_at:304:593; Interrogation_Position=965; Antisense; TGGGAACCGAGGTCACTTTAGCTGT

Paste this into a BLAST search page for me
GCTTCTTTGGGAACACTTGCACGAGATGGGTCGGCACTTGGATTTGGTATATAACCGTGGGATCCTTTGTGGGCGTAGGTTTCAGTATTGTCACCCAGAAAGTTAGTATCTCTCGATTGCCGTCGATTGCCGTCGTCCTGGAGCTCATAAGAACTTTGTATTCGGCTCTAGCCTATAGGTGCCACTATTGCCATTTGTATGTGTTTCTATAATGCTACTGGACTTTACTGGACTTAGCATCTGCCTTCAATGCCTTCAAATATGCCAGTGGTCTACAGTGGTCTAGTGGCATTCGTCCTCATTCGTCCTCTACAACTTTGTCATCTGGGAACCGAGGTCACTTTAGCTGT

Full Affymetrix probeset data:

Annotations for 1625914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720