FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625915_at:

>probe:Drosophila_2:1625915_at:329:9; Interrogation_Position=339; Antisense; ATTCCGATTCCGATTTCGAGGAGGA
>probe:Drosophila_2:1625915_at:490:9; Interrogation_Position=363; Antisense; ATTCCCTTACTGATTCCGATGAGCA
>probe:Drosophila_2:1625915_at:175:497; Interrogation_Position=409; Antisense; GTCCGAATCGGAACACAGTGAAGTC
>probe:Drosophila_2:1625915_at:455:501; Interrogation_Position=431; Antisense; GTCGAGGAGCGTACCAAACCATCAG
>probe:Drosophila_2:1625915_at:405:403; Interrogation_Position=466; Antisense; GACTACCAACGGAGGTCTCTGCGAA
>probe:Drosophila_2:1625915_at:365:499; Interrogation_Position=480; Antisense; GTCTCTGCGAAAAACCAATCTCCAA
>probe:Drosophila_2:1625915_at:418:235; Interrogation_Position=496; Antisense; AATCTCCAAGGTCGAGCCTGAACAA
>probe:Drosophila_2:1625915_at:585:185; Interrogation_Position=516; Antisense; AACAATCTCGGCTCGTGGCCTTTGT
>probe:Drosophila_2:1625915_at:535:143; Interrogation_Position=580; Antisense; ACTGACTATGGCTGGTGGCGTTATA
>probe:Drosophila_2:1625915_at:144:477; Interrogation_Position=599; Antisense; GTTATAGCTCCTCATAGTCGCAGTA
>probe:Drosophila_2:1625915_at:105:677; Interrogation_Position=613; Antisense; TAGTCGCAGTAGTGCCTTCTAAATC
>probe:Drosophila_2:1625915_at:274:367; Interrogation_Position=654; Antisense; GAATCATTGGTCAAGCTAGGAGCTC
>probe:Drosophila_2:1625915_at:204:553; Interrogation_Position=672; Antisense; GGAGCTCGAGGTTTCTCCAATCGAT
>probe:Drosophila_2:1625915_at:347:233; Interrogation_Position=753; Antisense; AATCATATCGCGACTCATTTTGAAA

Paste this into a BLAST search page for me
ATTCCGATTCCGATTTCGAGGAGGAATTCCCTTACTGATTCCGATGAGCAGTCCGAATCGGAACACAGTGAAGTCGTCGAGGAGCGTACCAAACCATCAGGACTACCAACGGAGGTCTCTGCGAAGTCTCTGCGAAAAACCAATCTCCAAAATCTCCAAGGTCGAGCCTGAACAAAACAATCTCGGCTCGTGGCCTTTGTACTGACTATGGCTGGTGGCGTTATAGTTATAGCTCCTCATAGTCGCAGTATAGTCGCAGTAGTGCCTTCTAAATCGAATCATTGGTCAAGCTAGGAGCTCGGAGCTCGAGGTTTCTCCAATCGATAATCATATCGCGACTCATTTTGAAA

Full Affymetrix probeset data:

Annotations for 1625915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720