Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625918_a_at:

>probe:Drosophila_2:1625918_a_at:70:569; Interrogation_Position=280; Antisense; GGCATGGCACGATTTACAGCACTGA
>probe:Drosophila_2:1625918_a_at:114:207; Interrogation_Position=306; Antisense; AAGCTGCTGGACACCTACAAGAGGC
>probe:Drosophila_2:1625918_a_at:365:381; Interrogation_Position=381; Antisense; GAACCCGAGTTCATTTGCGTCCAAC
>probe:Drosophila_2:1625918_a_at:598:503; Interrogation_Position=399; Antisense; GTCCAACGGACTGTGATCGAGCTAA
>probe:Drosophila_2:1625918_a_at:223:497; Interrogation_Position=439; Antisense; GTCAGAGCCTCTACAGCGACAAGGA
>probe:Drosophila_2:1625918_a_at:393:151; Interrogation_Position=463; Antisense; ACATCGTCGTGTTCCTGATCAAGCA
>probe:Drosophila_2:1625918_a_at:420:173; Interrogation_Position=503; Antisense; AAACTCGCTGGTCACAAAGGAACTG
>probe:Drosophila_2:1625918_a_at:528:225; Interrogation_Position=519; Antisense; AAGGAACTGAGCACGCTGCTGGACT
>probe:Drosophila_2:1625918_a_at:610:37; Interrogation_Position=618; Antisense; ATCTACAACAATATATCGCCCACCA
>probe:Drosophila_2:1625918_a_at:383:133; Interrogation_Position=655; Antisense; ACCGCCTGTACAATTTGCTTCGAAA
>probe:Drosophila_2:1625918_a_at:700:617; Interrogation_Position=670; Antisense; TGCTTCGAAATATCCAGCCGGACGA
>probe:Drosophila_2:1625918_a_at:692:563; Interrogation_Position=748; Antisense; GGAAGGCAGCCCACAAGACCAAGTA
>probe:Drosophila_2:1625918_a_at:423:1; Interrogation_Position=769; Antisense; AGTAGTCGCACTGAAACTCAACCTC
>probe:Drosophila_2:1625918_a_at:177:563; Interrogation_Position=801; Antisense; GGAACTGTGTGCCTCCAAAACATTG

Paste this into a BLAST search page for me
GGCATGGCACGATTTACAGCACTGAAAGCTGCTGGACACCTACAAGAGGCGAACCCGAGTTCATTTGCGTCCAACGTCCAACGGACTGTGATCGAGCTAAGTCAGAGCCTCTACAGCGACAAGGAACATCGTCGTGTTCCTGATCAAGCAAAACTCGCTGGTCACAAAGGAACTGAAGGAACTGAGCACGCTGCTGGACTATCTACAACAATATATCGCCCACCAACCGCCTGTACAATTTGCTTCGAAATGCTTCGAAATATCCAGCCGGACGAGGAAGGCAGCCCACAAGACCAAGTAAGTAGTCGCACTGAAACTCAACCTCGGAACTGTGTGCCTCCAAAACATTG

Full Affymetrix probeset data:

Annotations for 1625918_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime