Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625919_at:

>probe:Drosophila_2:1625919_at:201:175; Interrogation_Position=555; Antisense; AAAGCCAGGATCTAGTGGCCCTGCT
>probe:Drosophila_2:1625919_at:686:577; Interrogation_Position=571; Antisense; GGCCCTGCTGCAGCGCTATACAAAA
>probe:Drosophila_2:1625919_at:26:361; Interrogation_Position=627; Antisense; GCAACGAGACATTGGGAGGCTTCAA
>probe:Drosophila_2:1625919_at:292:211; Interrogation_Position=671; Antisense; AAGAAGCAGTGCGTCCGTGTGGATC
>probe:Drosophila_2:1625919_at:684:375; Interrogation_Position=711; Antisense; GAAGACTCTGGCAGCAGCATCTGAA
>probe:Drosophila_2:1625919_at:486:367; Interrogation_Position=733; Antisense; GAATCGACTGCCAATGGTCACGCTG
>probe:Drosophila_2:1625919_at:17:261; Interrogation_Position=751; Antisense; CACGCTGGAAGTGGCCGAGTCCATA
>probe:Drosophila_2:1625919_at:667:431; Interrogation_Position=767; Antisense; GAGTCCATAATAGCGCAGTATCCCT
>probe:Drosophila_2:1625919_at:712:481; Interrogation_Position=784; Antisense; GTATCCCTGTCCCAAGAAACTGATC
>probe:Drosophila_2:1625919_at:458:195; Interrogation_Position=801; Antisense; AACTGATCGATCATTTCTCCAGCGA
>probe:Drosophila_2:1625919_at:480:283; Interrogation_Position=834; Antisense; CTGTCCAAAGTCTCGCCGATTTGAA
>probe:Drosophila_2:1625919_at:709:445; Interrogation_Position=867; Antisense; GATGCAATGGACCACAGCCTCTTCA
>probe:Drosophila_2:1625919_at:664:641; Interrogation_Position=886; Antisense; TCTTCACACCGAGCGACGTATTGGA
>probe:Drosophila_2:1625919_at:425:627; Interrogation_Position=946; Antisense; TGCCAAGGATCCCAATACTCTAATT

Paste this into a BLAST search page for me
AAAGCCAGGATCTAGTGGCCCTGCTGGCCCTGCTGCAGCGCTATACAAAAGCAACGAGACATTGGGAGGCTTCAAAAGAAGCAGTGCGTCCGTGTGGATCGAAGACTCTGGCAGCAGCATCTGAAGAATCGACTGCCAATGGTCACGCTGCACGCTGGAAGTGGCCGAGTCCATAGAGTCCATAATAGCGCAGTATCCCTGTATCCCTGTCCCAAGAAACTGATCAACTGATCGATCATTTCTCCAGCGACTGTCCAAAGTCTCGCCGATTTGAAGATGCAATGGACCACAGCCTCTTCATCTTCACACCGAGCGACGTATTGGATGCCAAGGATCCCAATACTCTAATT

Full Affymetrix probeset data:

Annotations for 1625919_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime