FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625924_at:

>probe:Drosophila_2:1625924_at:650:53; Interrogation_Position=124; Antisense; ATGCACAGATGTGCGACCGCCTGTT
>probe:Drosophila_2:1625924_at:580:417; Interrogation_Position=181; Antisense; GAGCGGTGCATCGATCGCTGCCAAA
>probe:Drosophila_2:1625924_at:114:165; Interrogation_Position=203; Antisense; AAATCCGTTTGACCCGATCACGCTG
>probe:Drosophila_2:1625924_at:183:35; Interrogation_Position=219; Antisense; ATCACGCTGCTTCGTACAGCAGGGT
>probe:Drosophila_2:1625924_at:640:489; Interrogation_Position=232; Antisense; GTACAGCAGGGTATATCCGATTTTG
>probe:Drosophila_2:1625924_at:657:367; Interrogation_Position=258; Antisense; GAATCGCCTAGAGAAGTGCATCCAG
>probe:Drosophila_2:1625924_at:96:321; Interrogation_Position=287; Antisense; GCCGCCTCAATGGATCCGATTATAG
>probe:Drosophila_2:1625924_at:232:15; Interrogation_Position=308; Antisense; ATAGCTTGGAACGTTGCACCAGCAA
>probe:Drosophila_2:1625924_at:281:309; Interrogation_Position=326; Antisense; CCAGCAACTGCGTGGATAGCCATGT
>probe:Drosophila_2:1625924_at:280:673; Interrogation_Position=342; Antisense; TAGCCATGTGGGATTGTTGCCCGAA
>probe:Drosophila_2:1625924_at:422:571; Interrogation_Position=375; Antisense; GGCTATGCGAGATACCCTGGAGAAA
>probe:Drosophila_2:1625924_at:308:423; Interrogation_Position=47; Antisense; GAGAACGCGTTGACAATGCAATCCT
>probe:Drosophila_2:1625924_at:63:233; Interrogation_Position=61; Antisense; AATGCAATCCTAACCGCCATGGAGG
>probe:Drosophila_2:1625924_at:105:41; Interrogation_Position=86; Antisense; ATCTGGATCGGGATTATCTGCGCAA

Paste this into a BLAST search page for me
ATGCACAGATGTGCGACCGCCTGTTGAGCGGTGCATCGATCGCTGCCAAAAAATCCGTTTGACCCGATCACGCTGATCACGCTGCTTCGTACAGCAGGGTGTACAGCAGGGTATATCCGATTTTGGAATCGCCTAGAGAAGTGCATCCAGGCCGCCTCAATGGATCCGATTATAGATAGCTTGGAACGTTGCACCAGCAACCAGCAACTGCGTGGATAGCCATGTTAGCCATGTGGGATTGTTGCCCGAAGGCTATGCGAGATACCCTGGAGAAAGAGAACGCGTTGACAATGCAATCCTAATGCAATCCTAACCGCCATGGAGGATCTGGATCGGGATTATCTGCGCAA

Full Affymetrix probeset data:

Annotations for 1625924_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720