FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625925_at:

>probe:Drosophila_2:1625925_at:162:717; Interrogation_Position=16; Antisense; TTCGTGTTCCGTGCGTAAAGTGAAC
>probe:Drosophila_2:1625925_at:111:679; Interrogation_Position=22; Antisense; TTCCGTGCGTAAAGTGAACTAAGTG
>probe:Drosophila_2:1625925_at:383:247; Interrogation_Position=367; Antisense; AATTGCACAAGGTGGCGTGTTGCCT
>probe:Drosophila_2:1625925_at:56:357; Interrogation_Position=371; Antisense; GCACAAGGTGGCGTGTTGCCTAATA
>probe:Drosophila_2:1625925_at:116:223; Interrogation_Position=375; Antisense; AAGGTGGCGTGTTGCCTAATATACA
>probe:Drosophila_2:1625925_at:161:515; Interrogation_Position=383; Antisense; GTGTTGCCTAATATACAGGCTGTTC
>probe:Drosophila_2:1625925_at:645:279; Interrogation_Position=390; Antisense; CTAATATACAGGCTGTTCTGTTGCC
>probe:Drosophila_2:1625925_at:145:1; Interrogation_Position=434; Antisense; GCCTAAACGTTTCAAAGGCTAAGCT
>probe:Drosophila_2:1625925_at:538:569; Interrogation_Position=450; Antisense; GGCTAAGCTAAAAACCTACATGTAC
>probe:Drosophila_2:1625925_at:22:167; Interrogation_Position=461; Antisense; AAACCTACATGTACATAAAATCGTC
>probe:Drosophila_2:1625925_at:475:489; Interrogation_Position=471; Antisense; GTACATAAAATCGTCAATCAAACCG
>probe:Drosophila_2:1625925_at:93:177; Interrogation_Position=51; Antisense; AAACGCAAAGCAAAATGTCTGGACG
>probe:Drosophila_2:1625925_at:596:243; Interrogation_Position=536; Antisense; AATTTTTTAGCTTGGCAATTTGTTG
>probe:Drosophila_2:1625925_at:594:337; Interrogation_Position=545; Antisense; GCTTGGCAATTTGTTGTAATTAGTA

Paste this into a BLAST search page for me
TTCGTGTTCCGTGCGTAAAGTGAACTTCCGTGCGTAAAGTGAACTAAGTGAATTGCACAAGGTGGCGTGTTGCCTGCACAAGGTGGCGTGTTGCCTAATAAAGGTGGCGTGTTGCCTAATATACAGTGTTGCCTAATATACAGGCTGTTCCTAATATACAGGCTGTTCTGTTGCCGCCTAAACGTTTCAAAGGCTAAGCTGGCTAAGCTAAAAACCTACATGTACAAACCTACATGTACATAAAATCGTCGTACATAAAATCGTCAATCAAACCGAAACGCAAAGCAAAATGTCTGGACGAATTTTTTAGCTTGGCAATTTGTTGGCTTGGCAATTTGTTGTAATTAGTA

Full Affymetrix probeset data:

Annotations for 1625925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720