FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625927_at:

>probe:Drosophila_2:1625927_at:501:89; Interrogation_Position=1759; Antisense; AGTCTTCGTCTTATGTGGTTCGCAA
>probe:Drosophila_2:1625927_at:562:519; Interrogation_Position=1773; Antisense; GTGGTTCGCAAATCAGCAATTCGCA
>probe:Drosophila_2:1625927_at:427:361; Interrogation_Position=1788; Antisense; GCAATTCGCAATCCGTAAGCACCAG
>probe:Drosophila_2:1625927_at:267:331; Interrogation_Position=1828; Antisense; GCGGCAGCATCGAGGTATCCCAATA
>probe:Drosophila_2:1625927_at:571:417; Interrogation_Position=1944; Antisense; GAGCTGGCAGTATCAATTGCGCTGA
>probe:Drosophila_2:1625927_at:4:719; Interrogation_Position=1960; Antisense; TTGCGCTGAGGTGAGTCCAACACTT
>probe:Drosophila_2:1625927_at:57:243; Interrogation_Position=2006; Antisense; AATATATAACACTCGGGCGCCATTG
>probe:Drosophila_2:1625927_at:314:625; Interrogation_Position=2031; Antisense; TGCCCCTTCACATTCTGTAGACATA
>probe:Drosophila_2:1625927_at:654:485; Interrogation_Position=2047; Antisense; GTAGACATACTCGTTTTCGTATCAT
>probe:Drosophila_2:1625927_at:392:483; Interrogation_Position=2065; Antisense; GTATCATTACTCTACTCTCGTATAT
>probe:Drosophila_2:1625927_at:707:515; Interrogation_Position=2141; Antisense; GTGTCCCCTCAATATGTGTGTGTGT
>probe:Drosophila_2:1625927_at:193:79; Interrogation_Position=2191; Antisense; AGGATTTCACCAAGGTCCACCAGTT
>probe:Drosophila_2:1625927_at:690:641; Interrogation_Position=2215; Antisense; TCTTCGAAACGGACAGACGGACCTA
>probe:Drosophila_2:1625927_at:241:699; Interrogation_Position=2280; Antisense; TTTTAGTCAAGCACCACAGGCACTT

Paste this into a BLAST search page for me
AGTCTTCGTCTTATGTGGTTCGCAAGTGGTTCGCAAATCAGCAATTCGCAGCAATTCGCAATCCGTAAGCACCAGGCGGCAGCATCGAGGTATCCCAATAGAGCTGGCAGTATCAATTGCGCTGATTGCGCTGAGGTGAGTCCAACACTTAATATATAACACTCGGGCGCCATTGTGCCCCTTCACATTCTGTAGACATAGTAGACATACTCGTTTTCGTATCATGTATCATTACTCTACTCTCGTATATGTGTCCCCTCAATATGTGTGTGTGTAGGATTTCACCAAGGTCCACCAGTTTCTTCGAAACGGACAGACGGACCTATTTTAGTCAAGCACCACAGGCACTT

Full Affymetrix probeset data:

Annotations for 1625927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720