FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625928_at:

>probe:Drosophila_2:1625928_at:707:459; Interrogation_Position=1078; Antisense; GATTACGTTTGGCAACTCCGGCGGT
>probe:Drosophila_2:1625928_at:347:503; Interrogation_Position=1101; Antisense; GTCCCTTGGTCAATCTGGATGGCGA
>probe:Drosophila_2:1625928_at:526:509; Interrogation_Position=1151; Antisense; GTGACGGCTGGCATTAGCTTCGCAA
>probe:Drosophila_2:1625928_at:255:117; Interrogation_Position=1166; Antisense; AGCTTCGCAATACCCATTGACTATG
>probe:Drosophila_2:1625928_at:306:83; Interrogation_Position=1230; Antisense; AGGGCTCGGCCTACAAGACTGGCTA
>probe:Drosophila_2:1625928_at:658:613; Interrogation_Position=1260; Antisense; TGAAGCGGTACATGGGCATCACCAT
>probe:Drosophila_2:1625928_at:8:261; Interrogation_Position=1296; Antisense; CACCGGATATTCTGTTCGAGCTCAA
>probe:Drosophila_2:1625928_at:209:687; Interrogation_Position=1377; Antisense; TTATCGTTGGGTCACCGGCGCACAG
>probe:Drosophila_2:1625928_at:15:201; Interrogation_Position=1413; Antisense; AACCCGGAGACATAGTGACCCACAT
>probe:Drosophila_2:1625928_at:178:547; Interrogation_Position=1465; Antisense; GGATGTCTACGATGCCCTGGCGGAT
>probe:Drosophila_2:1625928_at:667:97; Interrogation_Position=1533; Antisense; AGATGCACGTGACCATTACGCCAGA
>probe:Drosophila_2:1625928_at:418:11; Interrogation_Position=1547; Antisense; ATTACGCCAGAAGATCCCTAGTTTA
>probe:Drosophila_2:1625928_at:595:91; Interrogation_Position=1566; Antisense; AGTTTAACCTGTATGCAGCACCTGT
>probe:Drosophila_2:1625928_at:585:351; Interrogation_Position=1580; Antisense; GCAGCACCTGTACCCAATTGTATAT

Paste this into a BLAST search page for me
GATTACGTTTGGCAACTCCGGCGGTGTCCCTTGGTCAATCTGGATGGCGAGTGACGGCTGGCATTAGCTTCGCAAAGCTTCGCAATACCCATTGACTATGAGGGCTCGGCCTACAAGACTGGCTATGAAGCGGTACATGGGCATCACCATCACCGGATATTCTGTTCGAGCTCAATTATCGTTGGGTCACCGGCGCACAGAACCCGGAGACATAGTGACCCACATGGATGTCTACGATGCCCTGGCGGATAGATGCACGTGACCATTACGCCAGAATTACGCCAGAAGATCCCTAGTTTAAGTTTAACCTGTATGCAGCACCTGTGCAGCACCTGTACCCAATTGTATAT

Full Affymetrix probeset data:

Annotations for 1625928_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720