Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625930_at:

>probe:Drosophila_2:1625930_at:298:543; Interrogation_Position=3402; Antisense; GGATATCCTATCCTTCATTATATAA
>probe:Drosophila_2:1625930_at:37:55; Interrogation_Position=3436; Antisense; ATGAAAATATTCTAGCTCGCTTTGA
>probe:Drosophila_2:1625930_at:693:341; Interrogation_Position=3454; Antisense; GCTTTGATCTTTTAATGTGTGTATA
>probe:Drosophila_2:1625930_at:281:383; Interrogation_Position=3507; Antisense; GAACTATGCACAAATACCGGTTGAA
>probe:Drosophila_2:1625930_at:300:67; Interrogation_Position=3544; Antisense; ATGGAAAAGCAACCGCATGTGAGCG
>probe:Drosophila_2:1625930_at:523:565; Interrogation_Position=3623; Antisense; GGCAAGGGAGCCATCAGCATCAGCA
>probe:Drosophila_2:1625930_at:277:37; Interrogation_Position=3671; Antisense; ATCATCGCCAGCGTCGAGAGCTCTT
>probe:Drosophila_2:1625930_at:507:329; Interrogation_Position=3681; Antisense; GCGTCGAGAGCTCTTTCGATCGAAA
>probe:Drosophila_2:1625930_at:512:43; Interrogation_Position=3715; Antisense; ATCGAGTGCGATTCGTCAACAAGGC
>probe:Drosophila_2:1625930_at:397:185; Interrogation_Position=3802; Antisense; AAAATTGCTTTGCACTCTGGCACAC
>probe:Drosophila_2:1625930_at:573:583; Interrogation_Position=3819; Antisense; TGGCACACTGCTATGTAAATATGTT
>probe:Drosophila_2:1625930_at:695:427; Interrogation_Position=3845; Antisense; GAGATTCAACTTTTACAAATTCTAT
>probe:Drosophila_2:1625930_at:31:257; Interrogation_Position=3860; Antisense; CAAATTCTATTTTCCAAGTCCAAGT
>probe:Drosophila_2:1625930_at:632:105; Interrogation_Position=3896; Antisense; AGAACTATCGTGCTTAAGGCATTAT

Paste this into a BLAST search page for me
GGATATCCTATCCTTCATTATATAAATGAAAATATTCTAGCTCGCTTTGAGCTTTGATCTTTTAATGTGTGTATAGAACTATGCACAAATACCGGTTGAAATGGAAAAGCAACCGCATGTGAGCGGGCAAGGGAGCCATCAGCATCAGCAATCATCGCCAGCGTCGAGAGCTCTTGCGTCGAGAGCTCTTTCGATCGAAAATCGAGTGCGATTCGTCAACAAGGCAAAATTGCTTTGCACTCTGGCACACTGGCACACTGCTATGTAAATATGTTGAGATTCAACTTTTACAAATTCTATCAAATTCTATTTTCCAAGTCCAAGTAGAACTATCGTGCTTAAGGCATTAT

Full Affymetrix probeset data:

Annotations for 1625930_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime