Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625931_at:

>probe:Drosophila_2:1625931_at:111:703; Interrogation_Position=3106; Antisense; TTAATCCTAGATCGTGTAAACCGGT
>probe:Drosophila_2:1625931_at:110:55; Interrogation_Position=3134; Antisense; AGTTTTCGGCCGGAATCAGGTCAAG
>probe:Drosophila_2:1625931_at:352:573; Interrogation_Position=3141; Antisense; GGCCGGAATCAGGTCAAGTTTTAAG
>probe:Drosophila_2:1625931_at:409:175; Interrogation_Position=3179; Antisense; AAACCAAGTTTGACCATCGAGCTGA
>probe:Drosophila_2:1625931_at:668:417; Interrogation_Position=3197; Antisense; GAGCTGAATGAACCAACTCGAATTA
>probe:Drosophila_2:1625931_at:538:485; Interrogation_Position=3251; Antisense; GTAGACTCTCAATAACAACACATTT
>probe:Drosophila_2:1625931_at:140:259; Interrogation_Position=3269; Antisense; CACATTTTCTTTGTTGCCTTTTACA
>probe:Drosophila_2:1625931_at:468:469; Interrogation_Position=3281; Antisense; GTTGCCTTTTACACCAACACTATTA
>probe:Drosophila_2:1625931_at:367:157; Interrogation_Position=3337; Antisense; ACACGCTTTCGTATCTCATTTAGTT
>probe:Drosophila_2:1625931_at:410:369; Interrogation_Position=3408; Antisense; GAATGATCTTTGCTTCCAAATGATG
>probe:Drosophila_2:1625931_at:556:663; Interrogation_Position=3504; Antisense; TACAAAAATTCGCATACCACCCATT
>probe:Drosophila_2:1625931_at:610:27; Interrogation_Position=3517; Antisense; ATACCACCCATTATGCGTAGTTAAA
>probe:Drosophila_2:1625931_at:495:271; Interrogation_Position=3548; Antisense; CATTTCCTAGTTGTGTTGAGTGGTA
>probe:Drosophila_2:1625931_at:121:231; Interrogation_Position=3612; Antisense; AATGATCGTAAACCCGTGCTATGTA

Paste this into a BLAST search page for me
TTAATCCTAGATCGTGTAAACCGGTAGTTTTCGGCCGGAATCAGGTCAAGGGCCGGAATCAGGTCAAGTTTTAAGAAACCAAGTTTGACCATCGAGCTGAGAGCTGAATGAACCAACTCGAATTAGTAGACTCTCAATAACAACACATTTCACATTTTCTTTGTTGCCTTTTACAGTTGCCTTTTACACCAACACTATTAACACGCTTTCGTATCTCATTTAGTTGAATGATCTTTGCTTCCAAATGATGTACAAAAATTCGCATACCACCCATTATACCACCCATTATGCGTAGTTAAACATTTCCTAGTTGTGTTGAGTGGTAAATGATCGTAAACCCGTGCTATGTA

Full Affymetrix probeset data:

Annotations for 1625931_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime