Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625932_at:

>probe:Drosophila_2:1625932_at:222:295; Interrogation_Position=3595; Antisense; CGCTCTTAACCGAGGATCACCTGGT
>probe:Drosophila_2:1625932_at:152:35; Interrogation_Position=3610; Antisense; ATCACCTGGTTAACTCGCTGGGCAT
>probe:Drosophila_2:1625932_at:582:207; Interrogation_Position=3654; Antisense; AAGCTGCGCTCCATATTGGCGAAGA
>probe:Drosophila_2:1625932_at:294:631; Interrogation_Position=3695; Antisense; TCCGTGTGTTGCATGCGTTGCGCAG
>probe:Drosophila_2:1625932_at:48:167; Interrogation_Position=3727; Antisense; AAATGCTGGCACTGCAAACGGGTGG
>probe:Drosophila_2:1625932_at:376:553; Interrogation_Position=3810; Antisense; GGAGCGGGAGCAACATCGGCCACAA
>probe:Drosophila_2:1625932_at:383:469; Interrogation_Position=3838; Antisense; GTTGCAGCATCAAGTCGGAGATCTT
>probe:Drosophila_2:1625932_at:580:427; Interrogation_Position=3855; Antisense; GAGATCTTCAATGGCGGCAGCAACG
>probe:Drosophila_2:1625932_at:526:203; Interrogation_Position=3903; Antisense; AACCAGGGCAGCGATGTTGCAGCTC
>probe:Drosophila_2:1625932_at:396:153; Interrogation_Position=3961; Antisense; ACATGTTGCTGCCAGTGTTGCCGTG
>probe:Drosophila_2:1625932_at:473:289; Interrogation_Position=3989; Antisense; CGGACTGCAGGACGCCAGCTAGTTA
>probe:Drosophila_2:1625932_at:419:117; Interrogation_Position=4005; Antisense; AGCTAGTTAGCAGCGATCCTGTCCA
>probe:Drosophila_2:1625932_at:561:325; Interrogation_Position=4017; Antisense; GCGATCCTGTCCACATACGTATTTA
>probe:Drosophila_2:1625932_at:597:105; Interrogation_Position=4129; Antisense; AGACAGGCAGACAGGCGCCTCGGAT

Paste this into a BLAST search page for me
CGCTCTTAACCGAGGATCACCTGGTATCACCTGGTTAACTCGCTGGGCATAAGCTGCGCTCCATATTGGCGAAGATCCGTGTGTTGCATGCGTTGCGCAGAAATGCTGGCACTGCAAACGGGTGGGGAGCGGGAGCAACATCGGCCACAAGTTGCAGCATCAAGTCGGAGATCTTGAGATCTTCAATGGCGGCAGCAACGAACCAGGGCAGCGATGTTGCAGCTCACATGTTGCTGCCAGTGTTGCCGTGCGGACTGCAGGACGCCAGCTAGTTAAGCTAGTTAGCAGCGATCCTGTCCAGCGATCCTGTCCACATACGTATTTAAGACAGGCAGACAGGCGCCTCGGAT

Full Affymetrix probeset data:

Annotations for 1625932_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime