FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625933_at:

>probe:Drosophila_2:1625933_at:481:669; Interrogation_Position=1454; Antisense; TACGATCTGCACGAGACCCTTAAAG
>probe:Drosophila_2:1625933_at:695:613; Interrogation_Position=1518; Antisense; TGAATCGTACTCTGCGACTGCGAAA
>probe:Drosophila_2:1625933_at:555:33; Interrogation_Position=1545; Antisense; ATCACAACGTTTCATTATTCCTGCC
>probe:Drosophila_2:1625933_at:205:607; Interrogation_Position=1576; Antisense; TGAGGAGCGTAGCTGCTTCTCTGCC
>probe:Drosophila_2:1625933_at:530:631; Interrogation_Position=1606; Antisense; TCCGCTTCACTATTGCCAATGCGAT
>probe:Drosophila_2:1625933_at:723:369; Interrogation_Position=1651; Antisense; GAATGTGCGTAGTATCCAGCGGATT
>probe:Drosophila_2:1625933_at:225:595; Interrogation_Position=1687; Antisense; TGTGGCCAACATCAATCGACTGCTT
>probe:Drosophila_2:1625933_at:224:723; Interrogation_Position=1710; Antisense; TTGCACCCTATCCACAGTGTGAACA
>probe:Drosophila_2:1625933_at:37:177; Interrogation_Position=1791; Antisense; AAACGATCATTGTGCGACTGGTGAC
>probe:Drosophila_2:1625933_at:712:47; Interrogation_Position=1839; Antisense; ATGCCACGGTCCTTTCCAAAAATGA
>probe:Drosophila_2:1625933_at:104:55; Interrogation_Position=1860; Antisense; ATGAAACCTCGCTGCAAGGACCTAT
>probe:Drosophila_2:1625933_at:81:157; Interrogation_Position=1906; Antisense; ACACCAATCATTTTGCGCCCGAGAA
>probe:Drosophila_2:1625933_at:180:379; Interrogation_Position=1928; Antisense; GAAGCTCCCATCGAGATTTATTGCT
>probe:Drosophila_2:1625933_at:514:727; Interrogation_Position=1970; Antisense; TTGTCTTCTGTCTTCGCATCTAAAA

Paste this into a BLAST search page for me
TACGATCTGCACGAGACCCTTAAAGTGAATCGTACTCTGCGACTGCGAAAATCACAACGTTTCATTATTCCTGCCTGAGGAGCGTAGCTGCTTCTCTGCCTCCGCTTCACTATTGCCAATGCGATGAATGTGCGTAGTATCCAGCGGATTTGTGGCCAACATCAATCGACTGCTTTTGCACCCTATCCACAGTGTGAACAAAACGATCATTGTGCGACTGGTGACATGCCACGGTCCTTTCCAAAAATGAATGAAACCTCGCTGCAAGGACCTATACACCAATCATTTTGCGCCCGAGAAGAAGCTCCCATCGAGATTTATTGCTTTGTCTTCTGTCTTCGCATCTAAAA

Full Affymetrix probeset data:

Annotations for 1625933_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720