Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625934_at:

>probe:Drosophila_2:1625934_at:53:443; Interrogation_Position=2245; Antisense; GATGTTGTTCAATCAGTGCCGGCAC
>probe:Drosophila_2:1625934_at:686:505; Interrogation_Position=2260; Antisense; GTGCCGGCACTATTAGACGTCTTAG
>probe:Drosophila_2:1625934_at:370:707; Interrogation_Position=2292; Antisense; TTACCTAGCCGAACAGAATCTCACC
>probe:Drosophila_2:1625934_at:259:171; Interrogation_Position=2317; Antisense; AAAGTGGTGGCCATCGTCCTCAACT
>probe:Drosophila_2:1625934_at:426:385; Interrogation_Position=2353; Antisense; GAACTTCTGGCTGACGTGGGCAAAC
>probe:Drosophila_2:1625934_at:57:567; Interrogation_Position=2371; Antisense; GGCAAACAACTGAGCGTGAGCGCAT
>probe:Drosophila_2:1625934_at:379:577; Interrogation_Position=2398; Antisense; GGCCGCTGCTTCGAACAGTTCGTGG
>probe:Drosophila_2:1625934_at:648:409; Interrogation_Position=2438; Antisense; GACGACTGGTGTGCGCCAACTGCGA
>probe:Drosophila_2:1625934_at:85:145; Interrogation_Position=2456; Antisense; ACTGCGAGTGCATATCTGGCGTGGA
>probe:Drosophila_2:1625934_at:202:561; Interrogation_Position=2484; Antisense; GGAACAGTTGGGACGCCACTTCTTC
>probe:Drosophila_2:1625934_at:27:313; Interrogation_Position=2498; Antisense; GCCACTTCTTCTACAACTGGAACTG
>probe:Drosophila_2:1625934_at:335:141; Interrogation_Position=2513; Antisense; ACTGGAACTGTTTCCTCAACATCGC
>probe:Drosophila_2:1625934_at:233:339; Interrogation_Position=2588; Antisense; GCTCATACATTCCAAACGACGCTAT
>probe:Drosophila_2:1625934_at:706:135; Interrogation_Position=2603; Antisense; ACGACGCTATCGACCGGGAGTTCTA

Paste this into a BLAST search page for me
GATGTTGTTCAATCAGTGCCGGCACGTGCCGGCACTATTAGACGTCTTAGTTACCTAGCCGAACAGAATCTCACCAAAGTGGTGGCCATCGTCCTCAACTGAACTTCTGGCTGACGTGGGCAAACGGCAAACAACTGAGCGTGAGCGCATGGCCGCTGCTTCGAACAGTTCGTGGGACGACTGGTGTGCGCCAACTGCGAACTGCGAGTGCATATCTGGCGTGGAGGAACAGTTGGGACGCCACTTCTTCGCCACTTCTTCTACAACTGGAACTGACTGGAACTGTTTCCTCAACATCGCGCTCATACATTCCAAACGACGCTATACGACGCTATCGACCGGGAGTTCTA

Full Affymetrix probeset data:

Annotations for 1625934_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime