Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1625935_at:

>probe:Drosophila_2:1625935_at:80:651; Interrogation_Position=2415; Antisense; TCACCACGGGAAGCACGATCGGAGT
>probe:Drosophila_2:1625935_at:152:433; Interrogation_Position=2436; Antisense; GAGTGCTCCTGGATCTAGAGCGGCA
>probe:Drosophila_2:1625935_at:357:275; Interrogation_Position=2470; Antisense; CTTCCTGGTCAACGAAATGCCGCAG
>probe:Drosophila_2:1625935_at:136:451; Interrogation_Position=2496; Antisense; GATCGGTGGCATTCCGGGATCTCTA
>probe:Drosophila_2:1625935_at:668:683; Interrogation_Position=2531; Antisense; TATCCGGCCGTGAGCATCAATCGAG
>probe:Drosophila_2:1625935_at:434:33; Interrogation_Position=2546; Antisense; ATCAATCGAGGCGTCACTCTGACCA
>probe:Drosophila_2:1625935_at:533:157; Interrogation_Position=2574; Antisense; ACACGGCCATGGATGCGCCCAAGAT
>probe:Drosophila_2:1625935_at:447:273; Interrogation_Position=2661; Antisense; CATTTGGCAGTTATCGGTGTCTATA
>probe:Drosophila_2:1625935_at:516:91; Interrogation_Position=2762; Antisense; AGTTTTGGGCAAAGTTCAGCGACAT
>probe:Drosophila_2:1625935_at:272:325; Interrogation_Position=2780; Antisense; GCGACATATCTCCATTTAATCGTAT
>probe:Drosophila_2:1625935_at:498:279; Interrogation_Position=2805; Antisense; CTCTATTCGTAGTTTTAGGCACTGT
>probe:Drosophila_2:1625935_at:516:355; Interrogation_Position=2823; Antisense; GCACTGTTTGTAAAACGCTGCGCCA
>probe:Drosophila_2:1625935_at:689:199; Interrogation_Position=2836; Antisense; AACGCTGCGCCAAATCGGATAGGAA
>probe:Drosophila_2:1625935_at:11:415; Interrogation_Position=2946; Antisense; GAGCCAAAAATCATGCACCGTGCAA

Paste this into a BLAST search page for me
TCACCACGGGAAGCACGATCGGAGTGAGTGCTCCTGGATCTAGAGCGGCACTTCCTGGTCAACGAAATGCCGCAGGATCGGTGGCATTCCGGGATCTCTATATCCGGCCGTGAGCATCAATCGAGATCAATCGAGGCGTCACTCTGACCAACACGGCCATGGATGCGCCCAAGATCATTTGGCAGTTATCGGTGTCTATAAGTTTTGGGCAAAGTTCAGCGACATGCGACATATCTCCATTTAATCGTATCTCTATTCGTAGTTTTAGGCACTGTGCACTGTTTGTAAAACGCTGCGCCAAACGCTGCGCCAAATCGGATAGGAAGAGCCAAAAATCATGCACCGTGCAA

Full Affymetrix probeset data:

Annotations for 1625935_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime